View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888-Insertion-31 (Length: 295)
Name: NF2888-Insertion-31
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888-Insertion-31 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 7 - 295
Target Start/End: Original strand, 11546104 - 11546387
Alignment:
| Q |
7 |
aaataataggaacaaaccgtgattgattattcgtcacacaaatatattaatcttctgatttgttacccagtttaacgtatcaaaaatttccttgactgaa |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11546104 |
aaataatagtaacaaaccgtgattgattattcgtcacacaaatatattaatcttctgatttgttacccagtttaacgtataaaaaatttccttgactgaa |
11546203 |
T |
 |
| Q |
107 |
aaatcacatgtcaatccaattgatattattgtgacgtaggaaacaatttccttaaccgtgtgcataaagaatattggcattcactatgtatatatcacat |
206 |
Q |
| |
|
| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11546204 |
acatcacatatcaatccaattgatattattgtgacgtaggaaacaatttccttaaccgtgtgcataaagaatattggcattcactatgtatatatcacat |
11546303 |
T |
 |
| Q |
207 |
atatacaaaacatgatatgttatgaaattgcaaaacaatactaacgtaacgtgtcaacaaatcttggatcatatccaaaccattatgtc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11546304 |
atatacaaaacatgatatgttatgaaattgcaaaacaata-----ttaacgtgtcaacaaatcttggatcatatccaaaccattatgtc |
11546387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University