View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888-Insertion-33 (Length: 170)
Name: NF2888-Insertion-33
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888-Insertion-33 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 4e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 7 - 170
Target Start/End: Complemental strand, 13644313 - 13644150
Alignment:
| Q |
7 |
attttgaagccttggacaggtagttcgcttcatctttatcatcatcatcctgaaatcattatatatcattaacgttttaaactatagtcacaataaggat |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13644313 |
attttgaagccttggacaggtagttctcttcatctttatcatcatcatcctgaaatcattatatatcattaacgttttaaactatagtcacaataaggat |
13644214 |
T |
 |
| Q |
107 |
agtgnnnnnnnnnnnngttgaacaagcataattaaggatagtgttctcatgcctcgatctttga |
170 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13644213 |
agtgttttttttttttgttgaacaagcataattaaggatagtgttctcatgcctcgatctttga |
13644150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University