View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888-Insertion-34 (Length: 141)
Name: NF2888-Insertion-34
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888-Insertion-34 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 4e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 8 - 141
Target Start/End: Original strand, 54794740 - 54794873
Alignment:
| Q |
8 |
atgcaatcactgcatcaaaaggtatttggtttgttagaccttgagcctttcaattgttcctgtctatcatggataattttgaaaagcaaatgatggaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54794740 |
atgcaatcactgcatcaaaaggtatttggtttgttagaccttgagcctttcaattgttcctgtctatcatggataattttgaaaagcaaatgatggaaaa |
54794839 |
T |
|
| Q |
108 |
tcaaacaatgactgatataatgcaccccgttcca |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54794840 |
tcaaacaatgactgatataatgcaccccgttcca |
54794873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 3e-37
Query Start/End: Original strand, 22 - 133
Target Start/End: Original strand, 52287522 - 52287628
Alignment:
| Q |
22 |
tcaaaaggtatttggtttgttagaccttgagcctttcaattgttcctgtctatcatggataattttgaaaagcaaatgatggaaaatcaaacaatgactg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52287522 |
tcaaaaggtatttggtttgttagaccttgggcctttcaattgttcctg----tcatggataattttgaaaagcaaatgatgg-aaatcaaacaatgactg |
52287616 |
T |
|
| Q |
122 |
atataatgcacc |
133 |
Q |
| |
|
||||||| |||| |
|
|
| T |
52287617 |
atataatacacc |
52287628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 30 - 106
Target Start/End: Original strand, 802656 - 802732
Alignment:
| Q |
30 |
tatttggtttgttagaccttgagcctttcaattgttcctgtctatcatggataattttgaaaagcaaatgatggaaa |
106 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
802656 |
tatttggtttgttagaacttgaggctttcaattgctcctgtctatcatggataattttgaaaagcaaaagatggaaa |
802732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University