View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888R-Insertion-5 (Length: 187)
Name: NF2888R-Insertion-5
Description: NF2888R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888R-Insertion-5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 2e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 7791409 - 7791573
Alignment:
| Q |
19 |
gaagtctgatatggactttaaacatctcacttatt---catcttatgatatgaatgaaaatctaaccatcacactattttgatnnnnnnnnnntagtgtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
7791409 |
gaagtctgatatggactttaaacatctcatttattattcatcttatgatatgaat----atctaaccatcacactattt-gataaaaaaaa--tagtgtt |
7791501 |
T |
|
| Q |
116 |
gtatttattaaaaatattctaaaccaagttttattcaagttttcgtcataaaagctttattaaattattttg |
187 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7791502 |
gtatttgttaaaaatattttaaaccaagttttattcaagttttcgtcataaaagctttattaaattattttg |
7791573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University