View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888R-Insertion-7 (Length: 165)
Name: NF2888R-Insertion-7
Description: NF2888R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888R-Insertion-7 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 3e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 9 - 165
Target Start/End: Original strand, 19270422 - 19270578
Alignment:
| Q |
9 |
aagataacatcgttaatattcggtgtccttttccaaagtgcaaaggttcgttggaagcggagttttgccgttttattctaccggctgaggtttttgatcg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || || |||||||||||||| |
|
|
| T |
19270422 |
aagataacatcgttaatattcggtgtccttttccaaagtgtaaaggttcgttggaagcggagttttgccgttttattctgcctgccgaggtttttgatcg |
19270521 |
T |
|
| Q |
109 |
ctggggtcaagggttgtgtgaggctatgttcgatgtttcagaaaagttctactgtcc |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19270522 |
ctggggtcaagggttgtgtgaggctatgttcgatgtttcagaaaagttctactgtcc |
19270578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 6e-23
Query Start/End: Original strand, 9 - 147
Target Start/End: Original strand, 19314710 - 19314848
Alignment:
| Q |
9 |
aagataacatcgttaatattcggtgtccttttccaaagtgcaaaggttcgttggaagcggagttttgccgttttattctaccggctgaggtttttgatcg |
108 |
Q |
| |
|
|||| |||||||| || |||| ||||||||||||| |||||||||||| ||||| ||||| |||||||||| |||||| ||||| |||||||||| || |
|
|
| T |
19314710 |
aagaaaacatcgtcaaaattcagtgtccttttccagggtgcaaaggttccttggaggcggatttttgccgttctattcttccggccaaggtttttgaacg |
19314809 |
T |
|
| Q |
109 |
ctggggtcaagggttgtgtgaggctatgttcgatgtttc |
147 |
Q |
| |
|
|||||| | | | | ||||||||| ||||||||||||| |
|
|
| T |
19314810 |
gtggggtaaggcgctttgtgaggctttgttcgatgtttc |
19314848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University