View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888R-Insertion-8 (Length: 135)
Name: NF2888R-Insertion-8
Description: NF2888R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888R-Insertion-8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 3e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 3e-43
Query Start/End: Original strand, 9 - 105
Target Start/End: Original strand, 40665484 - 40665580
Alignment:
| Q |
9 |
ttatcgtcccgtcagaaaaggagatctatttcttgtgcggggagggatgagaagtgtagagtttaaggtcattgaaactgatcctggggagttctgt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
40665484 |
ttatcgtcccgtcagaaaaggagatctatttcttgtgcggggagggatgagaagtgtagagtttaaggtcattgaaactgatcctggtgagtactgt |
40665580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 9 - 107
Target Start/End: Complemental strand, 40724570 - 40724472
Alignment:
| Q |
9 |
ttatcgtcccgtcagaaaaggagatctatttcttgtgcggggagggatgagaagtgtagagtttaaggtcattgaaactgatcctggggagttctgtgc |
107 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40724570 |
ttattgtccggtcagaaaaggagatctatttcttgtgcggggagggatgagaagtgtagaatttaaggtcaatgaaactgatcctggggagttctgtgc |
40724472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University