View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888_high_12 (Length: 253)
Name: NF2888_high_12
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888_high_12 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 86 - 253
Target Start/End: Original strand, 19931120 - 19931289
Alignment:
| Q |
86 |
ataacaataacatcacgtgggtgaaattatagaaaagaaaaggtcccaaccaaccaacaaaacctaagtttctcaacaagctagaggtggtgtctcaata |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19931120 |
ataacaataacatcacgtgggtgaaattatagaaaagaaaaggtcccaaccaaccaacaaaacctaagtttctcaacaagctagcggtggtgtctcaata |
19931219 |
T |
 |
| Q |
186 |
tttatttgcacgcgttactcgtttctttgtatacttg--tctctctcaactatgtcttttacgtgtccat |
253 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19931220 |
tttttttgcacgcgttactcgtttctttttatacttgtctctctctcaactatgtcttttacgtgtccat |
19931289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 6 - 86
Target Start/End: Original strand, 19931007 - 19931087
Alignment:
| Q |
6 |
agcagcacagaggcacagttacaacatcctatgcaaatccatttaatacaccctatcgacagagcagcagaataaaaacaa |
86 |
Q |
| |
|
|||| |||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19931007 |
agcaacacaaaggcacagttacaacatcctatacaaatccatttaatacaccctatcgacagagcagcagaataaaaacaa |
19931087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University