View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888_low_11 (Length: 270)
Name: NF2888_low_11
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 140 - 258
Target Start/End: Original strand, 41601406 - 41601524
Alignment:
| Q |
140 |
acagtaggtagatctatgataattttgttcaaaggtgtctatctctttttcagtaattaattcatcttttataaacaaattattttcctattatatccaa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41601406 |
acagtaggtagatctatgataattttgttcaaaggtgtctatctctttttcagtaattaattcatcttttataaacaaattattttcctattatatccaa |
41601505 |
T |
|
| Q |
240 |
aataatggtccatacccta |
258 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41601506 |
aataatggtccatacccta |
41601524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 17 - 67
Target Start/End: Original strand, 41601283 - 41601333
Alignment:
| Q |
17 |
atatcctacttttcatctcactttgttgttcggatttagatcttctccttc |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41601283 |
atatcctacttttcatctcactttgttgttcggatttagatcttctccttc |
41601333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University