View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888_low_13 (Length: 243)
Name: NF2888_low_13
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 82 - 228
Target Start/End: Original strand, 19931641 - 19931787
Alignment:
| Q |
82 |
atctcaagaattaagccatggtgtaattgcaacacttgcaaaacattcttaaccatgagttggtccaataaatttgtaaaccttgtggattattatacac |
181 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19931641 |
atctcaagaatcaagccatggtgtaattgcaacacttgcaaaacattcttaaccatgagttggtccaataaatttgtaaaccttgtggattattatacac |
19931740 |
T |
 |
| Q |
182 |
atcttcttcaagaatcaccaacaggaacaattcatgtgcatgtgttg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19931741 |
atcttcttcaagaatcaccaacaggaacaattcatgtgcatgtgttg |
19931787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University