View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888_low_17 (Length: 235)
Name: NF2888_low_17
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 9 - 222
Target Start/End: Complemental strand, 4974715 - 4974502
Alignment:
| Q |
9 |
aacacagtgagatagaaactgatttaagtagcctccacagataatatctcaagttcagcccaccatagtggtgagagtcttggaacagcttgctcaggtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4974715 |
aacacagtgagatagaaactgatttaagtagcctccacagataatatctcaagttcagcccaccatagtggtgagagtcttggaacagcttgctcaggtg |
4974616 |
T |
|
| Q |
109 |
ttacacaaagcacttcccttaatctggaagttatgtctctcattgtaggtctcatctttggatcaggttggatgcacccttgaatcacttcacaaattac |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4974615 |
ttacacaaaacacttcccttaatctggaagttatgtctctcattgtaggtctcatctttggatcaggttggatgcacccttgaatcacttcacaaattac |
4974516 |
T |
|
| Q |
209 |
atcaagttcattgt |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4974515 |
atcaagttcattgt |
4974502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 9 - 222
Target Start/End: Complemental strand, 4992623 - 4992410
Alignment:
| Q |
9 |
aacacagtgagatagaaactgatttaagtagcctccacagataatatctcaagttcagcccaccatagtggtgagagtcttggaacagcttgctcaggtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4992623 |
aacacagtgagatagaaactgatttaagtagcctccacagataatatctcaagttcagcccaccatagtggtgagagtcttggaacagcttgctcaggtg |
4992524 |
T |
|
| Q |
109 |
ttacacaaagcacttcccttaatctggaagttatgtctctcattgtaggtctcatctttggatcaggttggatgcacccttgaatcacttcacaaattac |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4992523 |
ttacacaaaacacttcccttaatctggaagttatgtctctcattgtaggtctcatctttggatcaggttggatgcacccttgaatcacttcacaaattac |
4992424 |
T |
|
| Q |
209 |
atcaagttcattgt |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4992423 |
atcaagttcattgt |
4992410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 35831220 - 35831314
Alignment:
| Q |
33 |
taagtagcctccacagataatatctcaagttcagcccaccatagtggtgagagtcttggaacagcttgctcaggtgttacacaaagcacttccct |
127 |
Q |
| |
|
||||| |||||||| || || ||||| |||||||||||||| ||||| || |||||||| || ||||| ||||||| || | ||||||||||||| |
|
|
| T |
35831220 |
taagtggcctccaccgacaagatctcgagttcagcccaccagagtggagaaagtcttggtactgcttgatcaggtgatatagaaagcacttccct |
35831314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University