View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888_low_19 (Length: 216)
Name: NF2888_low_19
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 9 - 197
Target Start/End: Complemental strand, 40665672 - 40665484
Alignment:
| Q |
9 |
acatcatcataaccaacttcatcaagtctttcttcatcctctcttttcacaggttccccctcacagaagacctcagtgtctggagcaaccacacagaact |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||| |
|
|
| T |
40665672 |
acatcatcataaccaacttcatcaagtctttcttcatcatctcttttcacaggttccccctcacagaagatctcagtgtctggagcaaccgtacagtact |
40665573 |
T |
|
| Q |
109 |
ccccaggatcagtttcaatgaccttaaactctacacttctcatccctccccgcacaagaaatagatctccttttctgacgggacgataa |
197 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40665572 |
caccaggatcagtttcaatgaccttaaactctacacttctcatccctccccgcacaagaaatagatctccttttctgacgggacgataa |
40665484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 9 - 197
Target Start/End: Original strand, 40724382 - 40724570
Alignment:
| Q |
9 |
acatcatcataaccaacttcatcaagtctttcttcatcctctcttttcacaggttccccctcacagaagacctcagtgtctggagcaaccacacagaact |
108 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40724382 |
acatcatcataaccgacttcatcaagcctttcttcatcctctcttttcacgggttccccctcgcagaagacctcagtgtctggagcaaccgcacagaact |
40724481 |
T |
|
| Q |
109 |
ccccaggatcagtttcaatgaccttaaactctacacttctcatccctccccgcacaagaaatagatctccttttctgacgggacgataa |
197 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
40724482 |
ccccaggatcagtttcattgaccttaaattctacacttctcatccctccccgcacaagaaatagatctccttttctgaccggacaataa |
40724570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University