View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888_low_8 (Length: 311)
Name: NF2888_low_8
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 41520973 - 41520674
Alignment:
| Q |
1 |
accaactgaattaagcttatgaggactgtcaaattatctttataacacaatagcaaattttatgtctatcaaacgtttatcatatatttaaaagatttga |
100 |
Q |
| |
|
||||||||| |||||||||||||||| || |||| ||||||||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
41520973 |
accaactgagttaagcttatgaggacggttaaatgatctttataacacaataacaaattttatgtctattaatcgtttatcatatatttaaaagatttga |
41520874 |
T |
 |
| Q |
101 |
ttatgcatcgatcaaccgtgttagcatatactgatttttgttttatatggctataatttcaaaccaagttatgactttttgtcaaaaactaatcaagtca |
200 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41520873 |
ttatgtattgatcaaccgtgttagcatatactgatttttgttttatatggctataatttcaaaccaagttatgactttttgtcaaaaactaatcaagtca |
41520774 |
T |
 |
| Q |
201 |
cattgtattattaaatccataactgtaagtaccgtactatcaattatttttaacttctatttgttaatatatctctatggtctc-tttcttttcattcat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41520773 |
cattgtattattaaatccataactgtaagtaccgtactatcaattatttttaacttctatttgttaatatatctctatggtctcttttcttttcattcat |
41520674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University