View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2889_high_1 (Length: 604)
Name: NF2889_high_1
Description: NF2889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2889_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 78 - 274
Target Start/End: Complemental strand, 664390 - 664194
Alignment:
| Q |
78 |
ttgttgttgttacagttcgaaaaagacctaattacgatggatggtttcacggattcttagatgttggagctgtagctactcagcataacggtgaagacgt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
664390 |
ttgttgttgttacagttcgaaaaagacctaattacgatggatggtttcacggattcttagatgttggagctgtagctactcagcataacggtgaagacgt |
664291 |
T |
 |
| Q |
178 |
tgttcctcttgctctttcgttcgctaaggtgtgaaagattcgattttgattatacccttttgtttttatgcagaaaatatcatgtgggtcacccttg |
274 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
664290 |
tgttcctcttgcgctttcgttcgctaaggtttgaaagattcgattttgattatacccttttgtttttatgcagaaaatatcatgcgggtcacccttg |
664194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 2e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 484 - 549
Target Start/End: Original strand, 38709328 - 38709393
Alignment:
| Q |
484 |
caagggactaggatcgaggctgtttagatctccctcagcctcttggtggttctctgttcaactgtc |
549 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38709328 |
caagggactagggtcgaggctgtttagatctccctcagcctcttggtggttctctgttcaactgtc |
38709393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 361 - 415
Target Start/End: Original strand, 38709204 - 38709258
Alignment:
| Q |
361 |
gttcgtgtctactggttgtcgtgtttaggagctccggatcttctatgtgctcagc |
415 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38709204 |
gttcgtgtctgccggttgtcgtgtttaggagctccggatcttctctgtgctcagc |
38709258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 2e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 541
Target Start/End: Original strand, 39368219 - 39368269
Alignment:
| Q |
491 |
ctaggatcgaggctgtttagatctccctcagcctcttggtggttctctgtt |
541 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39368219 |
ctagggtcgaggctgtttagatctccctcagcctcttggtggttctctgtt |
39368269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 376 - 404
Target Start/End: Original strand, 29685002 - 29685030
Alignment:
| Q |
376 |
ttgtcgtgtttaggagctccggatcttct |
404 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29685002 |
ttgtcgtgtttaggagctccggatcttct |
29685030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 484 - 535
Target Start/End: Original strand, 1578157 - 1578208
Alignment:
| Q |
484 |
caagggactaggatcgaggctgtttagatctccctcagcctcttggtggttc |
535 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
1578157 |
caagggactagggtcgaggctggttagatctccctcagccttttggtggttc |
1578208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 484 - 543
Target Start/End: Complemental strand, 8045091 - 8045032
Alignment:
| Q |
484 |
caagggactaggatcgaggctgtttagatctccctcagcctcttggtggttctctgttca |
543 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||| | |||||| ||||||| |||||| |
|
|
| T |
8045091 |
caagggactagggtcgaggttgtttagatctccctccgtctcttgatggttctatgttca |
8045032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 491 - 534
Target Start/End: Original strand, 2569582 - 2569625
Alignment:
| Q |
491 |
ctaggatcgaggctgtttagatctccctcagcctcttggtggtt |
534 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2569582 |
ctagggtcgagactgtttagatctccctcagcctcttggtggtt |
2569625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 492 - 535
Target Start/End: Complemental strand, 26500913 - 26500870
Alignment:
| Q |
492 |
taggatcgaggctgtttagatctccctcagcctcttggtggttc |
535 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
26500913 |
tagggtcgaggctgtctagatctccctcagccttttggtggttc |
26500870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 506 - 543
Target Start/End: Complemental strand, 17332964 - 17332927
Alignment:
| Q |
506 |
tttagatctccctcagcctcttggtggttctctgttca |
543 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
17332964 |
tttagatctccctcatcctcttggtggttctctattca |
17332927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University