View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2889_high_10 (Length: 320)

Name: NF2889_high_10
Description: NF2889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2889_high_10
NF2889_high_10
[»] chr5 (72 HSPs)
chr5 (8-240)||(38962929-38963161)
chr5 (177-240)||(294028-294091)
chr5 (177-240)||(29151618-29151681)
chr5 (177-240)||(42207342-42207405)
chr5 (177-237)||(25779000-25779060)
chr5 (177-240)||(2217693-2217756)
chr5 (177-240)||(6118330-6118393)
chr5 (177-240)||(15635477-15635540)
chr5 (177-240)||(18633796-18633859)
chr5 (177-240)||(23382145-23382208)
chr5 (177-240)||(31037497-31037560)
chr5 (177-240)||(35165995-35166058)
chr5 (177-240)||(38496521-38496584)
chr5 (177-237)||(37090580-37090640)
chr5 (177-240)||(4203554-4203617)
chr5 (177-240)||(5614365-5614428)
chr5 (177-240)||(16038575-16038638)
chr5 (177-240)||(16616463-16616526)
chr5 (177-240)||(27850212-27850275)
chr5 (177-240)||(29172625-29172688)
chr5 (177-240)||(29692928-29692991)
chr5 (177-240)||(35167001-35167064)
chr5 (177-240)||(36577821-36577884)
chr5 (179-240)||(21125109-21125170)
chr5 (177-240)||(10409033-10409095)
chr5 (177-240)||(18046187-18046250)
chr5 (177-240)||(21050675-21050738)
chr5 (177-240)||(28550927-28550990)
chr5 (177-240)||(29875501-29875564)
chr5 (177-240)||(30888262-30888325)
chr5 (177-236)||(33335864-33335923)
chr5 (177-240)||(39379330-39379393)
chr5 (177-239)||(38786259-38786321)
chr5 (177-240)||(5950274-5950337)
chr5 (177-240)||(7075797-7075860)
chr5 (177-238)||(14318239-14318300)
chr5 (178-238)||(28863672-28863732)
chr5 (177-240)||(30800687-30800750)
chr5 (177-240)||(40029240-40029303)
chr5 (178-240)||(27916564-27916626)
chr5 (178-238)||(3850465-3850525)
chr5 (178-238)||(10743893-10743953)
chr5 (188-238)||(5904210-5904260)
chr5 (184-238)||(10830638-10830692)
chr5 (184-226)||(20661057-20661099)
chr5 (178-226)||(29366799-29366847)
chr5 (178-237)||(22551155-22551214)
chr5 (177-240)||(24782112-24782175)
chr5 (184-238)||(1286884-1286938)
chr5 (184-226)||(20690840-20690882)
chr5 (192-238)||(28213490-28213536)
chr5 (184-238)||(35609382-35609436)
chr5 (181-238)||(3850662-3850719)
chr5 (177-226)||(9532291-9532340)
chr5 (178-226)||(13990708-13990756)
chr5 (186-226)||(17070646-17070686)
chr5 (182-238)||(26071397-26071453)
chr5 (184-239)||(37271542-37271597)
chr5 (184-238)||(4736379-4736433)
chr5 (188-238)||(5103847-5103897)
chr5 (184-226)||(15916395-15916437)
chr5 (183-236)||(25561814-25561868)
chr5 (192-238)||(31602264-31602310)
chr5 (194-236)||(36973472-36973514)
chr5 (184-238)||(40038604-40038658)
chr5 (188-237)||(42553757-42553806)
chr5 (193-238)||(42596571-42596616)
chr5 (178-238)||(9179760-9179820)
chr5 (184-240)||(11935805-11935861)
chr5 (178-214)||(26133275-26133311)
chr5 (194-238)||(32108926-32108970)
chr5 (178-238)||(34125408-34125467)
[»] chr8 (73 HSPs)
chr8 (177-240)||(22917763-22917826)
chr8 (177-240)||(1163013-1163076)
chr8 (177-240)||(4375791-4375854)
chr8 (177-240)||(6146784-6146847)
chr8 (177-240)||(8094581-8094644)
chr8 (177-240)||(19494220-19494283)
chr8 (177-240)||(25131210-25131273)
chr8 (177-240)||(28398875-28398938)
chr8 (177-240)||(38930403-38930466)
chr8 (177-240)||(40493054-40493117)
chr8 (178-240)||(4017005-4017067)
chr8 (178-240)||(21125857-21125919)
chr8 (177-239)||(21509796-21509858)
chr8 (177-240)||(1525911-1525974)
chr8 (177-240)||(6146616-6146679)
chr8 (181-240)||(16789209-16789268)
chr8 (177-240)||(33636424-33636487)
chr8 (177-240)||(40066595-40066658)
chr8 (177-240)||(1408190-1408253)
chr8 (177-240)||(14495236-14495299)
chr8 (177-240)||(16643879-16643942)
chr8 (177-240)||(24187668-24187731)
chr8 (177-232)||(24954855-24954910)
chr8 (103-240)||(32040209-32040344)
chr8 (177-240)||(7272522-7272585)
chr8 (177-240)||(10776334-10776397)
chr8 (177-232)||(22650568-22650623)
chr8 (177-235)||(1685216-1685274)
chr8 (184-238)||(35115536-35115590)
chr8 (178-238)||(15719758-15719818)
chr8 (178-238)||(33526155-33526215)
chr8 (177-238)||(14488816-14488877)
chr8 (178-238)||(14238852-14238912)
chr8 (29-102)||(19946277-19946352)
chr8 (178-238)||(19963099-19963159)
chr8 (178-238)||(43477351-43477411)
chr8 (182-237)||(23939654-23939709)
chr8 (177-240)||(27341426-27341489)
chr8 (177-240)||(29158456-29158519)
chr8 (177-220)||(30337023-30337066)
chr8 (184-238)||(28497363-28497417)
chr8 (184-238)||(29992138-29992192)
chr8 (177-226)||(18549305-18549354)
chr8 (177-226)||(32195381-32195430)
chr8 (178-238)||(10755369-10755429)
chr8 (178-238)||(29487949-29488009)
chr8 (178-226)||(32418529-32418577)
chr8 (178-226)||(40844386-40844434)
chr8 (178-238)||(43727268-43727328)
chr8 (182-237)||(17074006-17074061)
chr8 (182-237)||(17574209-17574264)
chr8 (184-238)||(8298696-8298750)
chr8 (184-238)||(13232307-13232361)
chr8 (177-238)||(14496914-14496975)
chr8 (189-238)||(15931106-15931155)
chr8 (184-237)||(20277801-20277854)
chr8 (184-237)||(21064428-21064481)
chr8 (178-238)||(7578369-7578429)
chr8 (178-238)||(35143684-35143743)
chr8 (187-238)||(2355997-2356048)
chr8 (184-222)||(5357616-5357654)
chr8 (184-238)||(6469503-6469557)
chr8 (184-238)||(7326195-7326249)
chr8 (184-238)||(7420339-7420393)
chr8 (184-238)||(42429957-42430011)
chr8 (189-226)||(2811555-2811592)
chr8 (184-237)||(25600340-25600393)
chr8 (184-237)||(36044629-36044682)
chr8 (184-236)||(1778673-1778725)
chr8 (194-238)||(4621191-4621235)
chr8 (190-238)||(9175209-9175257)
chr8 (184-236)||(13154995-13155047)
chr8 (184-236)||(24814814-24814866)
[»] chr7 (70 HSPs)
chr7 (177-240)||(1559542-1559605)
chr7 (177-240)||(30709425-30709488)
chr7 (177-238)||(28911679-28911740)
chr7 (177-240)||(488814-488877)
chr7 (177-240)||(1007065-1007128)
chr7 (177-240)||(5308523-5308586)
chr7 (177-240)||(6108533-6108596)
chr7 (177-240)||(7432053-7432116)
chr7 (177-240)||(22871162-22871225)
chr7 (177-240)||(37372741-37372804)
chr7 (177-240)||(39719455-39719518)
chr7 (177-240)||(45021597-45021660)
chr7 (177-240)||(12894238-12894301)
chr7 (177-240)||(19783916-19783979)
chr7 (177-240)||(21223508-21223571)
chr7 (177-240)||(25547327-25547390)
chr7 (177-240)||(31732287-31732350)
chr7 (177-240)||(35015055-35015118)
chr7 (177-240)||(39833005-39833068)
chr7 (177-240)||(45073478-45073541)
chr7 (177-240)||(46304218-46304281)
chr7 (178-240)||(48358913-48358975)
chr7 (177-240)||(14738700-14738763)
chr7 (177-240)||(17999560-17999623)
chr7 (177-240)||(19561249-19561312)
chr7 (177-240)||(21554589-21554652)
chr7 (177-240)||(30352662-30352725)
chr7 (177-240)||(44344627-44344690)
chr7 (177-240)||(44403088-44403151)
chr7 (178-240)||(18022468-18022530)
chr7 (178-240)||(18311682-18311744)
chr7 (177-240)||(44508820-44508883)
chr7 (178-240)||(10358105-10358167)
chr7 (178-236)||(31310519-31310577)
chr7 (184-237)||(35665984-35666037)
chr7 (177-236)||(35210352-35210411)
chr7 (177-238)||(19757851-19757912)
chr7 (178-237)||(45671314-45671373)
chr7 (184-238)||(46759810-46759864)
chr7 (195-240)||(1974162-1974207)
chr7 (178-238)||(20388376-20388436)
chr7 (184-238)||(9659464-9659518)
chr7 (184-238)||(27458508-27458562)
chr7 (179-220)||(17854315-17854356)
chr7 (178-219)||(37952909-37952950)
chr7 (182-226)||(3808028-3808072)
chr7 (194-238)||(6589080-6589124)
chr7 (178-238)||(13769874-13769933)
chr7 (178-226)||(23816885-23816933)
chr7 (193-237)||(28262916-28262960)
chr7 (182-226)||(35104125-35104169)
chr7 (178-238)||(46648516-46648575)
chr7 (184-240)||(46829145-46829201)
chr7 (191-238)||(19465733-19465780)
chr7 (195-238)||(38186599-38186642)
chr7 (184-226)||(2945694-2945736)
chr7 (184-238)||(5354955-5355009)
chr7 (184-214)||(6892003-6892033)
chr7 (194-236)||(28529108-28529150)
chr7 (184-226)||(35838033-35838075)
chr7 (192-226)||(37527271-37527305)
chr7 (184-226)||(39438878-39438920)
chr7 (184-238)||(39520507-39520561)
chr7 (184-238)||(48852553-48852607)
chr7 (184-237)||(16940871-16940924)
chr7 (194-238)||(11767036-11767080)
chr7 (196-236)||(14543799-14543839)
chr7 (104-132)||(23817009-23817037)
chr7 (178-238)||(24953989-24954049)
chr7 (194-238)||(30223580-30223624)
[»] chr6 (52 HSPs)
chr6 (177-240)||(31398377-31398440)
chr6 (177-240)||(2616071-2616134)
chr6 (177-240)||(14655606-14655669)
chr6 (177-240)||(15076040-15076103)
chr6 (177-240)||(15116773-15116836)
chr6 (177-240)||(17321390-17321453)
chr6 (177-240)||(17321523-17321586)
chr6 (177-240)||(24273939-24274002)
chr6 (177-240)||(30928881-30928944)
chr6 (177-240)||(33801579-33801642)
chr6 (177-240)||(8680877-8680940)
chr6 (177-240)||(10091135-10091198)
chr6 (177-240)||(31166971-31167034)
chr6 (177-240)||(34582631-34582694)
chr6 (178-240)||(317911-317973)
chr6 (178-240)||(26375794-26375856)
chr6 (179-240)||(15962131-15962192)
chr6 (177-237)||(543562-543622)
chr6 (177-240)||(777875-777939)
chr6 (177-237)||(24692820-24692880)
chr6 (177-236)||(494602-494661)
chr6 (177-240)||(1890161-1890224)
chr6 (177-240)||(3356337-3356400)
chr6 (177-240)||(7155898-7155961)
chr6 (177-240)||(11129302-11129365)
chr6 (177-240)||(19296242-19296305)
chr6 (178-240)||(6468508-6468570)
chr6 (178-240)||(6591277-6591339)
chr6 (178-240)||(7324029-7324091)
chr6 (177-240)||(32885774-32885837)
chr6 (178-238)||(19275879-19275939)
chr6 (178-238)||(21995167-21995227)
chr6 (184-238)||(24901347-24901401)
chr6 (178-238)||(2373331-2373391)
chr6 (178-238)||(14428751-14428811)
chr6 (178-238)||(33131626-33131686)
chr6 (177-240)||(5286687-5286753)
chr6 (177-225)||(17772014-17772062)
chr6 (184-235)||(25121337-25121388)
chr6 (184-238)||(15722719-15722773)
chr6 (182-238)||(1214801-1214857)
chr6 (178-238)||(12612196-12612256)
chr6 (184-220)||(13268218-13268254)
chr6 (194-238)||(13617648-13617692)
chr6 (189-236)||(11448650-11448701)
chr6 (184-226)||(12298927-12298969)
chr6 (184-238)||(14656012-14656066)
chr6 (184-238)||(19320876-19320930)
chr6 (184-238)||(30479168-30479222)
chr6 (184-238)||(31198724-31198778)
chr6 (184-237)||(8169991-8170043)
chr6 (194-226)||(3276203-3276235)
[»] chr4 (79 HSPs)
chr4 (177-240)||(13479371-13479434)
chr4 (177-240)||(24474798-24474861)
chr4 (177-240)||(41920920-41920983)
chr4 (177-240)||(50714401-50714464)
chr4 (177-240)||(51708863-51708926)
chr4 (178-240)||(53717009-53717071)
chr4 (177-240)||(4279170-4279233)
chr4 (177-240)||(6827709-6827772)
chr4 (177-240)||(18135951-18136014)
chr4 (177-240)||(27008243-27008306)
chr4 (177-240)||(29463749-29463812)
chr4 (177-240)||(34355065-34355128)
chr4 (177-240)||(34361981-34362044)
chr4 (177-240)||(35415401-35415464)
chr4 (177-240)||(36702101-36702164)
chr4 (177-236)||(38054646-38054705)
chr4 (177-240)||(41346054-41346117)
chr4 (177-240)||(41620091-41620154)
chr4 (177-240)||(49123159-49123222)
chr4 (177-240)||(55482306-55482369)
chr4 (177-240)||(3178784-3178847)
chr4 (177-232)||(9446168-9446223)
chr4 (177-240)||(18830946-18831009)
chr4 (177-240)||(22584446-22584509)
chr4 (177-240)||(27427944-27428007)
chr4 (177-240)||(32208642-32208705)
chr4 (177-240)||(52017705-52017768)
chr4 (178-240)||(55072492-55072554)
chr4 (179-232)||(13064260-13064313)
chr4 (177-240)||(123730-123793)
chr4 (179-240)||(16712529-16712590)
chr4 (178-238)||(2180411-2180471)
chr4 (177-237)||(18205256-18205316)
chr4 (177-240)||(46087860-46087921)
chr4 (177-236)||(5063105-5063164)
chr4 (177-240)||(35763790-35763853)
chr4 (178-238)||(22099749-22099809)
chr4 (182-238)||(45505730-45505786)
chr4 (178-238)||(45593328-45593387)
chr4 (196-240)||(50822134-50822178)
chr4 (178-238)||(51545808-51545868)
chr4 (184-238)||(11692870-11692924)
chr4 (184-238)||(12791811-12791865)
chr4 (184-237)||(7642491-7642544)
chr4 (178-226)||(32365196-32365244)
chr4 (189-233)||(52429825-52429869)
chr4 (178-238)||(52441862-52441922)
chr4 (184-238)||(5797657-5797711)
chr4 (184-226)||(5827764-5827806)
chr4 (177-240)||(9289368-9289427)
chr4 (184-238)||(13530488-13530542)
chr4 (182-224)||(14791717-14791759)
chr4 (184-238)||(25424149-25424203)
chr4 (184-226)||(46292441-46292483)
chr4 (184-237)||(25358407-25358460)
chr4 (177-226)||(29420387-29420436)
chr4 (184-237)||(50754094-50754146)
chr4 (184-237)||(51738309-51738362)
chr4 (46-102)||(10078252-10078308)
chr4 (187-239)||(19321682-19321734)
chr4 (192-236)||(54903315-54903359)
chr4 (178-217)||(11285605-11285644)
chr4 (184-239)||(42848227-42848282)
chr4 (184-239)||(47135887-47135942)
chr4 (184-226)||(4211610-4211652)
chr4 (188-226)||(20292167-20292205)
chr4 (184-238)||(24774264-24774318)
chr4 (188-226)||(31182238-31182276)
chr4 (184-238)||(31812032-31812086)
chr4 (184-238)||(36050395-36050449)
chr4 (184-238)||(51763039-51763093)
chr4 (184-238)||(54208662-54208716)
chr4 (178-220)||(8191244-8191288)
chr4 (184-237)||(14488025-14488078)
chr4 (189-238)||(41439902-41439951)
chr4 (194-238)||(5203130-5203174)
chr4 (184-236)||(29380717-29380769)
chr4 (178-226)||(43368566-43368614)
chr4 (184-236)||(52543568-52543620)
[»] chr3 (89 HSPs)
chr3 (177-240)||(275543-275606)
chr3 (177-240)||(20907293-20907356)
chr3 (177-240)||(39288735-39288798)
chr3 (177-240)||(12673841-12673904)
chr3 (177-240)||(13584105-13584168)
chr3 (177-240)||(16123242-16123305)
chr3 (177-240)||(19656739-19656802)
chr3 (177-240)||(22156031-22156094)
chr3 (177-240)||(26799990-26800053)
chr3 (177-240)||(30004554-30004617)
chr3 (177-240)||(37506968-37507031)
chr3 (177-240)||(45161213-45161276)
chr3 (177-240)||(45320816-45320879)
chr3 (178-240)||(29446057-29446119)
chr3 (177-240)||(3151947-3152010)
chr3 (177-240)||(4950203-4950266)
chr3 (177-240)||(8510316-8510379)
chr3 (177-240)||(10977079-10977142)
chr3 (177-240)||(20757500-20757563)
chr3 (177-240)||(21159652-21159715)
chr3 (177-240)||(29955400-29955463)
chr3 (177-240)||(39072049-39072112)
chr3 (177-240)||(39436944-39437007)
chr3 (177-240)||(51834778-51834841)
chr3 (178-240)||(5345525-5345587)
chr3 (179-237)||(20612738-20612796)
chr3 (177-239)||(47901901-47901963)
chr3 (177-236)||(7518287-7518346)
chr3 (177-240)||(10778568-10778631)
chr3 (177-240)||(14633723-14633786)
chr3 (177-240)||(28427444-28427507)
chr3 (177-240)||(30130258-30130321)
chr3 (177-240)||(34238699-34238762)
chr3 (177-236)||(40169493-40169552)
chr3 (189-240)||(49670674-49670725)
chr3 (177-240)||(9863239-9863303)
chr3 (178-240)||(18175889-18175951)
chr3 (177-237)||(3830232-3830292)
chr3 (178-238)||(4513459-4513519)
chr3 (178-238)||(30268585-30268645)
chr3 (178-226)||(51500536-51500584)
chr3 (177-240)||(25710708-25710771)
chr3 (177-240)||(31869793-31869856)
chr3 (186-240)||(30426121-30426175)
chr3 (177-239)||(45521650-45521712)
chr3 (177-226)||(46186620-46186669)
chr3 (184-240)||(7957062-7957118)
chr3 (178-226)||(15016597-15016645)
chr3 (178-226)||(51759922-51759970)
chr3 (177-240)||(50261777-50261839)
chr3 (188-238)||(20405060-20405110)
chr3 (184-238)||(40277931-40277985)
chr3 (195-237)||(40979479-40979521)
chr3 (179-237)||(50196401-50196459)
chr3 (178-226)||(4814751-4814799)
chr3 (178-225)||(28942627-28942674)
chr3 (178-237)||(46901203-46901261)
chr3 (184-238)||(4034826-4034880)
chr3 (184-238)||(9261991-9262045)
chr3 (184-226)||(36673072-36673114)
chr3 (184-238)||(45005995-45006049)
chr3 (188-238)||(47114651-47114701)
chr3 (178-240)||(53701461-53701523)
chr3 (188-238)||(54767284-54767334)
chr3 (184-225)||(8555158-8555199)
chr3 (184-237)||(9603738-9603791)
chr3 (185-238)||(38232445-38232498)
chr3 (184-237)||(39132745-39132798)
chr3 (178-226)||(15286354-15286402)
chr3 (178-238)||(30552246-30552306)
chr3 (189-237)||(51058703-51058751)
chr3 (184-236)||(52342421-52342473)
chr3 (184-223)||(27681426-27681465)
chr3 (187-238)||(36732750-36732801)
chr3 (179-238)||(45313700-45313759)
chr3 (192-238)||(2486739-2486785)
chr3 (184-238)||(9596932-9596986)
chr3 (194-240)||(30034307-30034353)
chr3 (191-237)||(35533393-35533439)
chr3 (184-226)||(50009029-50009071)
chr3 (184-238)||(52956537-52956591)
chr3 (188-238)||(53113496-53113546)
chr3 (187-236)||(28418653-28418702)
chr3 (193-238)||(44802451-44802496)
chr3 (182-238)||(16679801-16679857)
chr3 (194-238)||(35177374-35177418)
chr3 (194-238)||(35565627-35565671)
chr3 (198-238)||(43440614-43440654)
chr3 (188-236)||(53719166-53719214)
[»] chr1 (80 HSPs)
chr1 (177-240)||(3679725-3679788)
chr1 (177-240)||(15335130-15335193)
chr1 (177-240)||(31258441-31258504)
chr1 (177-240)||(990188-990251)
chr1 (177-240)||(2733285-2733348)
chr1 (177-240)||(12361112-12361175)
chr1 (177-240)||(13260087-13260150)
chr1 (177-240)||(18473373-18473436)
chr1 (177-240)||(19622757-19622820)
chr1 (177-240)||(32454126-32454189)
chr1 (177-240)||(41358499-41358562)
chr1 (178-240)||(45290559-45290621)
chr1 (177-240)||(4323930-4323993)
chr1 (177-240)||(7001732-7001795)
chr1 (177-240)||(17984532-17984595)
chr1 (177-240)||(21391214-21391276)
chr1 (177-240)||(32728885-32728948)
chr1 (177-240)||(48955901-48955964)
chr1 (178-240)||(24649452-24649514)
chr1 (178-239)||(29688269-29688330)
chr1 (177-236)||(14007588-14007647)
chr1 (177-240)||(32626729-32626792)
chr1 (177-240)||(34383047-34383110)
chr1 (177-240)||(35307946-35308009)
chr1 (177-240)||(41881195-41881258)
chr1 (177-240)||(44641271-44641333)
chr1 (178-240)||(18302219-18302281)
chr1 (177-239)||(50429047-50429108)
chr1 (178-238)||(46868329-46868389)
chr1 (177-240)||(1159676-1159739)
chr1 (177-240)||(10552149-10552212)
chr1 (177-240)||(21383203-21383266)
chr1 (177-236)||(26062058-26062117)
chr1 (178-240)||(4360370-4360432)
chr1 (182-240)||(35005491-35005549)
chr1 (177-238)||(1811109-1811170)
chr1 (177-238)||(22919783-22919844)
chr1 (177-238)||(26191459-26191520)
chr1 (178-238)||(18899973-18900033)
chr1 (177-240)||(26442736-26442797)
chr1 (178-238)||(33067569-33067629)
chr1 (177-240)||(7818938-7819001)
chr1 (178-240)||(33379989-33380051)
chr1 (184-238)||(48730455-48730509)
chr1 (184-237)||(8364814-8364867)
chr1 (177-226)||(13770590-13770639)
chr1 (179-240)||(22953393-22953454)
chr1 (178-238)||(16083154-16083214)
chr1 (177-238)||(11822104-11822165)
chr1 (177-226)||(20756120-20756169)
chr1 (177-213)||(26142521-26142557)
chr1 (178-238)||(34808296-34808356)
chr1 (178-238)||(37545790-37545850)
chr1 (178-226)||(48609445-48609493)
chr1 (178-238)||(52254283-52254343)
chr1 (178-225)||(29072600-29072647)
chr1 (178-225)||(45368702-45368749)
chr1 (201-240)||(49226361-49226400)
chr1 (188-238)||(19198786-19198836)
chr1 (184-238)||(24510051-24510105)
chr1 (189-239)||(42483167-42483217)
chr1 (184-226)||(49073902-49073944)
chr1 (188-240)||(18927890-18927942)
chr1 (178-226)||(27521676-27521724)
chr1 (192-236)||(51986415-51986459)
chr1 (177-220)||(292959-293002)
chr1 (184-239)||(10631364-10631419)
chr1 (184-235)||(26324787-26324838)
chr1 (178-220)||(3753312-3753354)
chr1 (184-238)||(4789417-4789471)
chr1 (184-238)||(10887342-10887396)
chr1 (184-214)||(12360712-12360742)
chr1 (184-238)||(16060704-16060758)
chr1 (184-238)||(17129921-17129975)
chr1 (192-238)||(18079516-18079562)
chr1 (192-238)||(32035632-32035678)
chr1 (186-220)||(32420208-32420242)
chr1 (188-240)||(12322718-12322770)
chr1 (184-236)||(19720913-19720965)
chr1 (194-238)||(24977898-24977942)
[»] chr2 (72 HSPs)
chr2 (178-240)||(38731929-38731991)
chr2 (177-240)||(8046430-8046493)
chr2 (177-240)||(19183884-19183947)
chr2 (177-240)||(23989937-23990000)
chr2 (177-240)||(26814064-26814127)
chr2 (177-240)||(38980089-38980152)
chr2 (177-240)||(41693838-41693901)
chr2 (177-236)||(41791119-41791178)
chr2 (177-240)||(44985722-44985785)
chr2 (177-240)||(3838099-3838162)
chr2 (177-240)||(5790734-5790797)
chr2 (177-240)||(7814442-7814505)
chr2 (177-240)||(7814575-7814638)
chr2 (177-240)||(24483632-24483695)
chr2 (177-240)||(37271938-37272001)
chr2 (177-240)||(40302077-40302140)
chr2 (177-240)||(40786561-40786624)
chr2 (178-240)||(17541612-17541674)
chr2 (177-237)||(16899996-16900056)
chr2 (177-237)||(16993387-16993447)
chr2 (177-237)||(26707972-26708032)
chr2 (177-237)||(43710480-43710540)
chr2 (177-240)||(12835427-12835490)
chr2 (177-240)||(22881806-22881869)
chr2 (177-240)||(25954262-25954325)
chr2 (177-240)||(26238912-26238975)
chr2 (177-240)||(31225817-31225879)
chr2 (177-240)||(43789027-43789090)
chr2 (177-240)||(44073642-44073705)
chr2 (178-240)||(24483500-24483562)
chr2 (177-238)||(43597339-43597400)
chr2 (177-237)||(14392969-14393029)
chr2 (177-240)||(17912550-17912614)
chr2 (177-240)||(20658160-20658223)
chr2 (177-240)||(33732960-33733023)
chr2 (177-240)||(1497780-1497843)
chr2 (177-236)||(10665084-10665143)
chr2 (177-240)||(11713680-11713743)
chr2 (177-239)||(19831632-19831694)
chr2 (177-226)||(43592146-43592195)
chr2 (29-102)||(12820892-12820967)
chr2 (178-238)||(45442415-45442475)
chr2 (177-240)||(29865348-29865411)
chr2 (184-238)||(31909316-31909370)
chr2 (177-238)||(32691413-32691474)
chr2 (178-226)||(31326101-31326149)
chr2 (192-238)||(3832388-3832434)
chr2 (184-238)||(4042727-4042781)
chr2 (184-238)||(20939162-20939216)
chr2 (184-238)||(23732166-23732220)
chr2 (184-226)||(29182277-29182319)
chr2 (192-238)||(34317915-34317961)
chr2 (184-237)||(1138091-1138144)
chr2 (184-237)||(25750804-25750857)
chr2 (185-238)||(44559246-44559299)
chr2 (190-226)||(13850635-13850671)
chr2 (178-226)||(44993909-44993957)
chr2 (195-238)||(5164333-5164376)
chr2 (178-217)||(36622349-36622388)
chr2 (184-238)||(4424004-4424058)
chr2 (184-238)||(4842940-4842994)
chr2 (184-238)||(16523098-16523152)
chr2 (184-238)||(27109151-27109205)
chr2 (192-238)||(34963998-34964044)
chr2 (184-214)||(37228831-37228861)
chr2 (184-238)||(40125075-40125129)
chr2 (192-226)||(42695985-42696019)
chr2 (184-238)||(43672041-43672095)
chr2 (188-237)||(11788166-11788214)
chr2 (185-237)||(1295385-1295437)
chr2 (177-240)||(10374913-10374972)
chr2 (196-236)||(36815673-36815713)
[»] scaffold0370 (1 HSPs)
scaffold0370 (177-240)||(125-188)
[»] scaffold0016 (1 HSPs)
scaffold0016 (177-240)||(10257-10320)
[»] scaffold0712 (1 HSPs)
scaffold0712 (177-240)||(5311-5374)
[»] scaffold0709 (1 HSPs)
scaffold0709 (177-240)||(5331-5394)
[»] scaffold0373 (1 HSPs)
scaffold0373 (177-240)||(8649-8712)
[»] scaffold0210 (1 HSPs)
scaffold0210 (177-240)||(14797-14860)
[»] scaffold0159 (1 HSPs)
scaffold0159 (177-240)||(35107-35170)
[»] scaffold0123 (1 HSPs)
scaffold0123 (177-240)||(17879-17942)
[»] scaffold0021 (1 HSPs)
scaffold0021 (177-240)||(12284-12347)
[»] scaffold0811 (1 HSPs)
scaffold0811 (177-240)||(1479-1542)
[»] scaffold0535 (1 HSPs)
scaffold0535 (177-240)||(8864-8926)
[»] scaffold0051 (1 HSPs)
scaffold0051 (177-240)||(5542-5605)
[»] scaffold0347 (1 HSPs)
scaffold0347 (178-240)||(4149-4211)
[»] scaffold0179 (1 HSPs)
scaffold0179 (177-236)||(3132-3191)
[»] scaffold0060 (1 HSPs)
scaffold0060 (177-238)||(8432-8493)
[»] scaffold0002 (1 HSPs)
scaffold0002 (178-238)||(94160-94220)
[»] scaffold0003 (1 HSPs)
scaffold0003 (178-238)||(366114-366174)
[»] scaffold0326 (2 HSPs)
scaffold0326 (186-233)||(4128-4175)
scaffold0326 (186-233)||(19310-19357)
[»] scaffold0166 (1 HSPs)
scaffold0166 (177-240)||(24495-24558)
[»] scaffold0005 (1 HSPs)
scaffold0005 (182-224)||(47972-48014)
[»] scaffold1001 (1 HSPs)
scaffold1001 (178-225)||(2878-2925)
[»] scaffold0684 (1 HSPs)
scaffold0684 (192-238)||(2412-2458)
[»] scaffold0119 (1 HSPs)
scaffold0119 (184-238)||(16832-16886)
[»] scaffold0085 (1 HSPs)
scaffold0085 (184-238)||(34922-34976)
[»] scaffold0105 (1 HSPs)
scaffold0105 (178-220)||(17819-17863)
[»] scaffold0007 (1 HSPs)
scaffold0007 (188-237)||(2615-2664)
[»] scaffold0065 (1 HSPs)
scaffold0065 (178-226)||(3770-3818)
[»] scaffold0026 (1 HSPs)
scaffold0026 (184-240)||(82450-82506)
[»] scaffold0011 (1 HSPs)
scaffold0011 (184-220)||(189437-189473)


Alignment Details
Target: chr5 (Bit Score: 150; Significance: 3e-79; HSPs: 72)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 8 - 240
Target Start/End: Complemental strand, 38963161 - 38962929
Alignment:
8 tagcataggtgctgtagaaataatagtggcagttacatatagggaaatataattatttagaggatatattatttgctttatatgatatgaaacataaaag 107  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38963161 tagcataggtgatgtagaaataatagtggcagttacatatagggaaatataattatttagaggatatattatttgctttatatgatatgaaacataaaag 38963062  T
108 gctaaaatatggttttagtctctgt--nnnnnnngaaattgtttttggtccttgcaaaannnnnnnnnnnngaaaatagtccctgaccccacttttgtga 205  Q
    |||||||||||||||||||||||||          ||||||||||||||| ||||||||            |||||||||||||||||||||||||||||    
38963061 gctaaaatatggttttagtctctgtaaaaaaaaaaaaattgtttttggtctttgcaaaa--ttttgtttttgaaaatagtccctgaccccacttttgtga 38962964  T
206 tgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||    
38962963 tgatttgcatacgtgacacattataactgaaccaa 38962929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 294091 - 294028
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
294091 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 294028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 29151618 - 29151681
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29151618 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 29151681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 42207342 - 42207405
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42207342 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 42207405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 177 - 237
Target Start/End: Complemental strand, 25779060 - 25779000
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25779060 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 25779000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 2217756 - 2217693
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
2217756 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 2217693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 6118393 - 6118330
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
6118393 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 6118330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 15635477 - 15635540
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
15635477 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 15635540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 18633859 - 18633796
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
18633859 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 18633796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 23382208 - 23382145
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
23382208 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa 23382145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 31037497 - 31037560
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
31037497 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 31037560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35166058 - 35165995
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
35166058 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 35165995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 38496521 - 38496584
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
38496521 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 38496584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 177 - 237
Target Start/End: Complemental strand, 37090640 - 37090580
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
37090640 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 37090580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 4203554 - 4203617
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||    
4203554 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacatattataattgaaccaa 4203617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 5614428 - 5614365
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
5614428 gaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 5614365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 16038638 - 16038575
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
16038638 gaaaatagtctctgaccccacttttgtgattatttgcatacgtgacacattataactgaaccaa 16038575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 16616463 - 16616526
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
16616463 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 16616526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 27850275 - 27850212
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||    
27850275 gaaaatagtccctgaccccacttttgtgatggtttgcatacgtggcacattataactgaaccaa 27850212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 29172625 - 29172688
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
29172625 gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa 29172688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 29692991 - 29692928
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||    
29692991 gaaaatagtccctgaccccacttttatgatgatttgcatacgtggcacattataactgaaccaa 29692928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35167064 - 35167001
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
35167064 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 35167001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 36577821 - 36577884
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
36577821 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 36577884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 179 - 240
Target Start/End: Complemental strand, 21125170 - 21125109
Alignment:
179 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||    
21125170 aaatagtccctgaccccacttttgtgataatttgcatacgtgacacattataattgaaccaa 21125109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 10409033 - 10409095
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||    
10409033 gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactaaaccaa 10409095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 18046250 - 18046187
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
18046250 gaaaatagtctctgaccccacttttgtgataatttgcatacgtgtcacattataactgaaccaa 18046187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 21050675 - 21050738
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||    
21050675 gaaaatagtccttgacctcacttttgtgatgatttgcatacgtggcacattataactgaaccaa 21050738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 28550927 - 28550990
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||    
28550927 gaaaatagtccctaaccccacttttgtgatgatttgcatacatggcacattataactgaaccaa 28550990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 29875501 - 29875564
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||    
29875501 gaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaa 29875564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 30888262 - 30888325
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||  || |||||||||||||||||||    
30888262 gaaaatagtccctgaccccacttttgtgatgatttgcatatatggcacattataactgaaccaa 30888325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 33335923 - 33335864
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||    
33335923 gaaaatagtccttgaccccacttttgtgattatttgcatacgtgacacattataactgaa 33335864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 39379330 - 39379393
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||    
39379330 gaaaatagtcccggatcccacttttatgatgatttgcatacgtgacacattataactgaaccaa 39379393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 38786259 - 38786321
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    |||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||    
38786259 gaaaatagtctctgacctcatttttgtgatgatttgcatacgtgacacattataactgaacca 38786321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 5950274 - 5950337
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||  |||||||||||||||||||||||||||||||| |||||||||||||| ||||    
5950274 gaaaatagtctttgaccccacttttgtgatgatttgcatacgtggcacattataactgatccaa 5950337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 7075860 - 7075797
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||| | ||||||||||||||||||||||| ||| |||||||||||||||||||    
7075860 gaaaatagtccctggctccacttttgtgatgatttgcatatgtggcacattataactgaaccaa 7075797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 14318300 - 14318239
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||| | ||||||||||||||||||||||||||||| || ||||||||    
14318300 gaaaatagtccctgaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacc 14318239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 28863732 - 28863672
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
28863732 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgtcacatgatgactgaacc 28863672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 30800750 - 30800687
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||  ||||||||||| |||||||||||||  ||||||||||||||||||    
30800750 gaaaatagtccctgacctgacttttgtgattatttgcatacgtggtacattataactgaaccaa 30800687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 40029240 - 40029303
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| || |||||||||||||||||   |||||||||||||||||||||||||||    
40029240 gaaaatagtccctaactccacttttgtgatgattgatatacgtgacacattataactgaaccaa 40029303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 27916564 - 27916626
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||| ||||||||| |||||||||||||||| || || ||||||||||    
27916564 aaaatagtccctgaccccatttttgtgataatttgcatacgtgacagatgatgactgaaccaa 27916626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 3850525 - 3850465
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||| |||||||| ||||||||||||||||||||||| ||||| || ||||||||    
3850525 aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 3850465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 10743953 - 10743893
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||| ||| ||||| || ||||||||    
10743953 aaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcacatgatgactgaacc 10743893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 5904260 - 5904210
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||| ||||||||||||||||||||||||||||| || |||||||||||    
5904260 ctgacctcacttttgtgatgatttgcatacgtgacatatgataactgaacc 5904210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 10830638 - 10830692
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||||||| ||||||||||  || ||||||||    
10830638 gtccctgaccccacttttgtgatgatttgcacacgtgacacaagatgactgaacc 10830692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 20661057 - 20661099
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||||||||||||||| |||||||||||    
20661057 gtccctgaccccacttttgtgatgatttgcacacgtgacacat 20661099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 29366847 - 29366799
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||| |||||||||||| |||||||||||||| ||||||||||||||    
29366847 aaaataatccctgaccccatttttgtgatgatttacatacgtgacacat 29366799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 237
Target Start/End: Complemental strand, 22551214 - 22551155
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||||||||||||||||||||  ||||||||||  |||| || |||||||    
22551214 aaaatagtccctgaccccacttttgtgatgagctgcatacgtggtacatgatgactgaac 22551155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 24782175 - 24782112
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||  || ||||||||||||||||||||| | ||||||| |||||||||    
24782175 gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaa 24782112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 1286938 - 1286884
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| |||||||||||||||||||||||  |||||||||| || ||||||||    
1286938 gtccctgtccccacttttgtgatgatttgcaagcgtgacacataatgactgaacc 1286884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 20690840 - 20690882
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||||||||||||||||||||||| || |||||    
20690840 gtccctgaccccacttttgtgatgatttgcatacatggcacat 20690882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 28213490 - 28213536
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||| ||||||||||| || ||||||||    
28213490 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 28213536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 35609382 - 35609436
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
35609382 gtccctgtcgccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 35609436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 181 - 238
Target Start/End: Complemental strand, 3850719 - 3850662
Alignment:
181 atagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||| ||||||||| || |||||||||||||||||||| ||||| || ||||||||    
3850719 atagtctctgaccccatttatgtgatgatttgcatacgtggcacatgatgactgaacc 3850662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 9532291 - 9532340
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||| | || ||||| |||||||||||||||||||||||||||||    
9532291 gaaaatagttcttggccccatttttgtgatgatttgcatacgtgacacat 9532340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 13990708 - 13990756
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||| |||||| | ||||||||||||||||||||||| |||||    
13990708 aaaatagtccatgaccctatttttgtgatgatttgcatacgtggcacat 13990756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 226
Target Start/End: Original strand, 17070646 - 17070686
Alignment:
186 ccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||||||||||||| ||||| |||||    
17070646 ccctgaccccacttttgtgatgatttgcacacgtggcacat 17070686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 238
Target Start/End: Original strand, 26071397 - 26071453
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||| ||||||||||||||||||||||||||| ||||  ||||| || ||||||||    
26071397 tagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatgactgaacc 26071453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 239
Target Start/End: Complemental strand, 37271597 - 37271542
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    ||||||||| ||||||||||||| ||||||| ||||| ||||| || |||||||||    
37271597 gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaacca 37271542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 4736433 - 4736379
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| |||||||||||||||| |||| ||||| ||||| || ||||||||    
4736433 gtccctgactccacttttgtgatgatctgcacacgtggcacatgatgactgaacc 4736379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 5103897 - 5103847
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||| |||||||||||||||||||||| | ||||||||| || ||||||||    
5103897 ctgatcccacttttgtgatgatttgcacatgtgacacatgatgactgaacc 5103847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 15916395 - 15916437
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||| |||||||||||||||||||| | |||||||||    
15916395 gtccctgacctcacttttgtgatgatttgcacatgtgacacat 15916437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 25561814 - 25561868
Alignment:
183 agtccctgaccccac-ttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||| |||||||||| ||||||||||||||||||| ||  |||||||||||||||    
25561814 agtctctgaccccaccttttgtgatgatttgcatatgtagcacattataactgaa 25561868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 31602264 - 31602310
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||| ||||| ||||| |||| ||||||    
31602264 ccccacttttgtgatgatttgcacacgtggcacatgataattgaacc 31602310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 236
Target Start/End: Original strand, 36973472 - 36973514
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||||||||||||| ||||||||||| || ||||||    
36973472 ccacttttgtgatgatttgcacacgtgacacatgatgactgaa 36973514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 40038604 - 40038658
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
40038604 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 40038658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 42553757 - 42553806
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||   ||||||||||| ||||||||||| ||||||||||    
42553757 ctgaccccactttacagatgatttgcacacgtgacacatgataactgaac 42553806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 193 - 238
Target Start/End: Original strand, 42596571 - 42596616
Alignment:
193 cccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||| | || |||||||| |||||||||||    
42596571 cccacttttgtgatgatttggacacatgacacatgataactgaacc 42596616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 9179820 - 9179760
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| | ||||||| | |||||||||||||| |||||| ||||| ||||| |||||    
9179820 aaaatagtctccgaccccattattgtgatgatttgcctacgtggcacatgataaccgaacc 9179760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 11935861 - 11935805
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||| ||||| |||||||||||| |||||  |||| |||||| ||||||    
11935861 gtccctgaccccccttttatgatgatttgcacacgtggtacatgataactcaaccaa 11935805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 214
Target Start/End: Complemental strand, 26133311 - 26133275
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgca 214  Q
    |||||||||||| |||||| |||||||||||||||||    
26133311 aaaatagtccctaaccccatttttgtgatgatttgca 26133275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 32108926 - 32108970
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| ||||| ||||| || ||||||||    
32108926 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 32108970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 34125408 - 34125467
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||| | |||| |||||||||||||||||| ||||| || ||||||||    
34125408 aaaatagtctctgaccc-atttttttgatgatttgcatacgtggcacatgatgactgaacc 34125467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 64; Significance: 6e-28; HSPs: 73)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 22917826 - 22917763
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22917826 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 22917763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 1163013 - 1163076
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
1163013 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 1163076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 4375791 - 4375854
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
4375791 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 4375854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 6146847 - 6146784
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
6146847 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 6146784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 8094581 - 8094644
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
8094581 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaa 8094644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 19494220 - 19494283
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
19494220 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 19494283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 25131210 - 25131273
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
25131210 gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa 25131273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 28398938 - 28398875
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
28398938 gaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 28398875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 38930403 - 38930466
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
38930403 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 38930466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 40493054 - 40493117
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
40493054 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 40493117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 4017005 - 4017067
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
4017005 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 4017067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 21125919 - 21125857
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
21125919 aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 21125857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 21509796 - 21509858
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
21509796 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 21509858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 1525911 - 1525974
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||    
1525911 gaaaatagtccctgaccccacttttgtgatgatttgcataagtggcacattataactgaaccaa 1525974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 6146616 - 6146679
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||    
6146616 gaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 6146679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 181 - 240
Target Start/End: Complemental strand, 16789268 - 16789209
Alignment:
181 atagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
16789268 atagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 16789209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 33636424 - 33636487
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||    
33636424 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacagaaccaa 33636487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 40066595 - 40066658
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||    
40066595 gaaaatagtctctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa 40066658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1408253 - 1408190
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||    
1408253 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcatattataactgaaccaa 1408190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 14495299 - 14495236
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||    
14495299 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacctaataactgaaccaa 14495236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 16643942 - 16643879
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||    
16643942 gaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaa 16643879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 24187668 - 24187731
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||    
24187668 gaaaatagtctctgaccccacttttgtgatgatttgcatacttggcacattataactgaaccaa 24187731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 232
Target Start/End: Complemental strand, 24954910 - 24954855
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataac 232  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
24954910 gaaaatagtccctgaccccacttttgtgatgatttgcataagtgacacattataac 24954855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 103 - 240
Target Start/End: Complemental strand, 32040344 - 32040209
Alignment:
103 aaaaggctaaaatatggttttagtctctgtnnnnnnngaaattgtttttggtccttgcaaaannnnnnnnnnnngaaaatagtccctgaccccacttttg 202  Q
    ||||||||||||||||||||||||| ||||        |||||||||||||||| |||||||            |||||||||| |||||||||||||||    
32040344 aaaaggctaaaatatggttttagtccctgtaaaaaa--aaattgtttttggtccctgcaaaattttttgtttttgaaaatagtctctgaccccacttttg 32040247  T
203 tgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||| ||| |||||| ||||||||    
32040246 tgatgatttgcatacgtggcacgttataattgaaccaa 32040209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 7272522 - 7272585
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||  |||||||||||||||||||||||||||||  ||||||||||||||||||    
7272522 gaaaatagtccctagccccacttttgtgatgatttgcatacgtgttacattataactgaaccaa 7272585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 10776397 - 10776334
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| ||||||||||||||||||||||| |||||||| |||||||| ||||||||||    
10776397 gaaaatagtccttgaccccacttttgtgatgattttcatacgtggcacattatgactgaaccaa 10776334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 232
Target Start/End: Original strand, 22650568 - 22650623
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataac 232  Q
    |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||    
22650568 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataac 22650623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 177 - 235
Target Start/End: Original strand, 1685216 - 1685274
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactga 235  Q
    |||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||    
1685216 gaaaataggccctaaccccacttttgtgatgatttgcatacgtggcacattataactga 1685274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 35115590 - 35115536
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||||||||||||||||||| || ||||||||    
35115590 gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaacc 35115536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 15719758 - 15719818
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
15719758 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 15719818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 33526155 - 33526215
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
33526155 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 33526215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 14488816 - 14488877
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||| ||||||||||||||||||| ||| ||||| || ||||||||    
14488816 gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacc 14488877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 14238852 - 14238912
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||| | || ||||||||    
14238852 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacctgatgactgaacc 14238912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 19946277 - 19946352
Alignment:
29 aatagtggcagttacata--tagggaaatataattatttagaggatatattatttgctttatatgatatgaaacat 102  Q
    ||||||||||||||||||  |||||| ||||| |||||||| ||||||| ||||| ||| ||||||||||||||||    
19946277 aatagtggcagttacataaatagggagatatagttatttaggggatatactattttcttcatatgatatgaaacat 19946352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 19963099 - 19963159
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| |||||||||||||||||||||||  | || |||||||||||    
19963099 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgataactgaacc 19963159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 43477411 - 43477351
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||| | ||||| || ||||||||    
43477411 aaaatagtccctgaccccatttttgtgatgatttgcatacgagtcacatgatgactgaacc 43477351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 23939654 - 23939709
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||||||||||||||||||||||||| | ||||||||| || |||||||    
23939654 tagtccctgaccccacttttgtgatgatttgcacatgtgacacatgatgactgaac 23939709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 27341489 - 27341426
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||| | || ||||| |||||| |||||||||||||||||||    
27341489 gaaaatagtctctgaccccacttttgcggtggtttgcttacgtggcacattataactgaaccaa 27341426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 29158456 - 29158519
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| || |||||||||||||||| ||||  |||||||||||| ||||||||||||||    
29158456 gaaaatagtctcttaccccacttttgtgataatttatatacgtgacacaatataactgaaccaa 29158519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 30337023 - 30337066
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtg 220  Q
    |||||||||||||||||||| |||||||||||||||||||||||    
30337023 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtg 30337066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 28497363 - 28497417
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||||||| ||||| ||||| || ||||||||    
28497363 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 28497417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 29992192 - 29992138
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||||||||||| || ||||||||||| || ||||||||    
29992192 gtccctgaccccacttttgtgatgatttacacacgtgacacatgatgactgaacc 29992138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 18549305 - 18549354
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||| ||||||||| ||||||||||||||||||||||| |||||    
18549305 gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacat 18549354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 32195381 - 32195430
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||| |||||||||||||| ||||||| ||||||||||||||||    
32195381 gaaaatagtctctgaccccacttttatgatgatatgcatacgtgacacat 32195430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 10755429 - 10755369
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||| ||| ||| ||||||||||||||||||||||| ||||| || ||||||||    
10755429 aaaatagtccccgactccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 10755369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 29488009 - 29487949
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||| |||||||| ||||||||||||||||||| ||| ||||| || ||||||||    
29488009 aaaatagtccttgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacc 29487949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 32418577 - 32418529
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||| ||||||||| ||||||||||||||||||||||| |||||    
32418577 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacat 32418529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 40844434 - 40844386
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||| |||| ||||||||||||||||||||||| |||||    
40844434 aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacat 40844386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 43727328 - 43727268
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||| |||||||| ||||||||||||||| ||||||| ||||| || ||||||||    
43727328 aaaatagtccttgaccccatttttgtgatgatttggatacgtggcacatgatgactgaacc 43727268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 182 - 237
Target Start/End: Complemental strand, 17074061 - 17074006
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||| |||||||| |||||||||||| ||||||||||| || |||||||    
17074061 tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac 17074006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 17574209 - 17574264
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||| |||||||| |||||||||||| ||||||||||| || |||||||    
17574209 tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac 17574264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 8298696 - 8298750
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||||    
8298696 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 8298750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 13232307 - 13232361
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
13232307 gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 13232361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 14496914 - 14496975
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||| |||||||||| || ||||||||||||||||||| ||| ||||| || ||||||||    
14496914 gaaaatcgtccctgacctcatttttgtgatgatttgcatatgtggcacatgatgactgaacc 14496975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 189 - 238
Target Start/End: Complemental strand, 15931155 - 15931106
Alignment:
189 tgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||||||||| ||||| ||||| || ||||||||    
15931155 tgaccccacttttgtgatgatttgcacacgtgtcacatgatgactgaacc 15931106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 20277801 - 20277854
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||| ||||||||||||||||||||| | ||||| ||||| ||||||||||    
20277801 gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac 20277854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 21064428 - 21064481
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||| ||||||||||||||||||||| | ||||| ||||| ||||||||||    
21064428 gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac 21064481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 7578429 - 7578369
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||  |||||| | ||||||||||||||||||||||| ||||| || ||||||||    
7578429 aaaatagtctttgacccaatttttgtgatgatttgcatacgtggcacatgatgactgaacc 7578369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 35143743 - 35143684
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||| |||||||| ||||||||||||||||||| ||| ||||| ||||| |||||    
35143743 aaaatagtccatgacccca-ttttgtgatgatttgcataagtggcacatgataaccgaacc 35143684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 2355997 - 2356048
Alignment:
187 cctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| |||||||||||||||||||| || |||||||| || ||||||||    
2355997 cctgacctcacttttgtgatgatttgcacacatgacacatgatgactgaacc 2356048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 222
Target Start/End: Complemental strand, 5357654 - 5357616
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgac 222  Q
    ||||||||| ||||||||||||||||||||| |||||||    
5357654 gtccctgactccacttttgtgatgatttgcacacgtgac 5357616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 6469557 - 6469503
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||| ||||  | ||||| |||||||| ||||||||    
6469557 gtccctgaccccacttttgtgattatttaaacacgtggcacattatgactgaacc 6469503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 7326195 - 7326249
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
7326195 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 7326249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 7420339 - 7420393
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
7420339 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 7420393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 42430011 - 42429957
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| ||||| ||||||||||||||||| ||||| ||||| || ||||||||    
42430011 gtccctggccccatttttgtgatgatttgcacacgtggcacatgatgactgaacc 42429957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 226
Target Start/End: Original strand, 2811555 - 2811592
Alignment:
189 tgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||||||||||||| ||||||| |||||    
2811555 tgaccccacttttgtgatgatttgtatacgtggcacat 2811592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 25600340 - 25600393
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||| | ||||||||||||||||||||| || |||||||| || |||||||    
25600340 gtccctgtctccacttttgtgatgatttgcacacatgacacatgatgactgaac 25600393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 36044682 - 36044629
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||| |||||||||||||||||||| | |||| |||| || |||||||    
36044682 gtccctgacctcacttttgtgatgatttgcacatgtgatacatgatgactgaac 36044629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 1778673 - 1778725
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||    
1778673 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaa 1778725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Complemental strand, 4621235 - 4621191
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| |||| |||||| || ||||||||    
4621235 ccacttttgtgatgatttgcacacgtcacacatgatgactgaacc 4621191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 190 - 238
Target Start/End: Complemental strand, 9175257 - 9175209
Alignment:
190 gaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||| || || ||||| || ||||||||    
9175257 gaccccacttttgtgatgatttgcacacatggcacatgatgactgaacc 9175209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 13154995 - 13155047
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||||||||||||  ||||||||| ||||| ||||| || ||||||    
13154995 gtccctgaccccacttttgtattgatttgcacacgtggcacatgatgactgaa 13155047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 24814814 - 24814866
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||||||||||||||||||| |||||||||| ||||  ||||| || ||||||    
24814814 gtccctgaccccacttttgttatgatttgcacacgtagcacatgatgactgaa 24814866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 6e-28; HSPs: 70)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1559605 - 1559542
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1559605 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 1559542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 30709425 - 30709488
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30709425 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 30709488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 28911679 - 28911740
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28911679 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 28911740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 488814 - 488877
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
488814 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 488877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1007128 - 1007065
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
1007128 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 1007065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 5308586 - 5308523
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
5308586 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 5308523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 6108596 - 6108533
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
6108596 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 6108533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 7432053 - 7432116
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7432053 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 7432116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 22871162 - 22871225
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22871162 gaaaatagaccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 22871225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 37372804 - 37372741
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
37372804 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgatacattataactgaaccaa 37372741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 39719455 - 39719518
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
39719455 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 39719518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 45021597 - 45021660
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
45021597 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 45021660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 12894301 - 12894238
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
12894301 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 12894238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 19783916 - 19783979
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
19783916 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 19783979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 21223508 - 21223571
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
21223508 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 21223571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 25547390 - 25547327
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
25547390 gaaaatagtctctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaa 25547327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 31732350 - 31732287
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||    
31732350 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaa 31732287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35015118 - 35015055
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||    
35015118 gaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 35015055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 39833005 - 39833068
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
39833005 gaaaatagttcctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 39833068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 45073541 - 45073478
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
45073541 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 45073478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 46304281 - 46304218
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
46304281 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 46304218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 48358975 - 48358913
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
48358975 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 48358913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 14738700 - 14738763
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||||    
14738700 gaaaatagtctctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 14738763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 17999623 - 17999560
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||    
17999623 gaaaatagtccctgaccccacgtttgtgataatttgcatacgtggcacattataactgaaccaa 17999560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 19561249 - 19561312
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||    
19561249 gaaaatagtccctgacaccacttttgtgatgatttgcatatgtggcacattataactgaaccaa 19561312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 21554652 - 21554589
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||    
21554652 gaaaatagtccctgaccccacttttgtgatgttttgcatatgtggcacattataactgaaccaa 21554589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 30352662 - 30352725
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||    
30352662 gaaaatagtccctgactccatttttgtgatgatttgcatacgtggcacattataactgaaccaa 30352725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 44344690 - 44344627
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||    
44344690 gaaaatagtcactgaccccacttttgtgatgattttcatacgtggcacattataactgaaccaa 44344627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 44403151 - 44403088
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||    
44403151 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataactgaaccaa 44403088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 18022468 - 18022530
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||| |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
18022468 aaaataatccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa 18022530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 18311682 - 18311744
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||    
18311682 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaa 18311744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 44508820 - 44508883
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||| |||||||||||||||| |||||||||| ||||||||    
44508820 gaaaatagtctctgaccccacttttgttatgatttgcatacgtggcacattataagtgaaccaa 44508883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 10358105 - 10358167
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||||    
10358105 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaa 10358167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 178 - 236
Target Start/End: Complemental strand, 31310577 - 31310519
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||    
31310577 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattatgactgaa 31310519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 35665984 - 35666037
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||||||||||||||||||||||||||||||||||| || |||||||    
35665984 gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaac 35666037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 35210411 - 35210352
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||| | ||||||||||||||||||| |||||||||| |||||||||||||||    
35210411 gaaaatagtccttaaccccacttttgtgatgatgtgcatacgtggcacattataactgaa 35210352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 19757851 - 19757912
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||| ||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
19757851 gaaaatagtcactgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 19757912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 178 - 237
Target Start/End: Original strand, 45671314 - 45671373
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||| ||||||||| || ||||||||||||||||||||||||||||| || |||||||    
45671314 aaaataatccctgacctcatttttgtgatgatttgcatacgtgacacatgatgactgaac 45671373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 46759864 - 46759810
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||||    
46759864 gtccctgactccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 46759810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 195 - 240
Target Start/End: Complemental strand, 1974207 - 1974162
Alignment:
195 cacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||| |||||||||||||||||||||||| ||||||||||||||||    
1974207 cactattgtgatgatttgcatacgtgacaaattataactgaaccaa 1974162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 20388376 - 20388436
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||| |||||||||| ||||||||||||||||||||||| || || || ||||||||    
20388376 aaaatagttcctgaccccatttttgtgatgatttgcatacgtggcatatgatgactgaacc 20388436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 9659464 - 9659518
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||||    
9659464 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 9659518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 27458508 - 27458562
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
27458508 gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 27458562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 220
Target Start/End: Complemental strand, 17854356 - 17854315
Alignment:
179 aaatagtccctgaccccacttttgtgatgatttgcatacgtg 220  Q
    |||||||||||||| ||| |||||||||||||||||||||||    
17854356 aaatagtccctgactccatttttgtgatgatttgcatacgtg 17854315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 178 - 219
Target Start/End: Complemental strand, 37952950 - 37952909
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgt 219  Q
    |||||||||| |||||||||||||||||| ||||||||||||    
37952950 aaaatagtccatgaccccacttttgtgattatttgcatacgt 37952909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 226
Target Start/End: Complemental strand, 3808072 - 3808028
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||| |||||| |||||||||||||||||||| |||||||||||    
3808072 tagtctctgacctcacttttgtgatgatttgcacacgtgacacat 3808028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 6589080 - 6589124
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| ||||||||||| || ||||||||    
6589080 ccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 6589124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 13769874 - 13769933
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||| |||||| | ||||||||||||||||||||||| ||||| || ||||||||    
13769874 aaaatagtcc-tgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacc 13769933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 23816933 - 23816885
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||| ||||||||| ||||||||||||||| ||||||| |||||    
23816933 aaaatagtctctgaccccatttttgtgatgatttgtatacgtggcacat 23816885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 193 - 237
Target Start/End: Complemental strand, 28262960 - 28262916
Alignment:
193 cccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||||||||||| ||||||||||| || |||||||    
28262960 cccacttttgtgatgatttgcacacgtgacacataatgactgaac 28262916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 226
Target Start/End: Original strand, 35104125 - 35104169
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||| ||||||||||||||||||||| ||||| |||||    
35104125 tagtccctgactccacttttgtgatgatttgcacacgtggcacat 35104169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 46648516 - 46648575
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||| |||||||| |||||||||||||||| |||||| ||||| || ||||||||    
46648516 aaaatagtcc-tgaccccatttttgtgatgatttgcgtacgtggcacatgatgactgaacc 46648575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 46829201 - 46829145
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| ||||||||||||||||||||| || |||||||| || | ||||||||    
46829201 gtccctgactccacttttgtgatgatttgcacacatgacacatgatgattgaaccaa 46829145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 191 - 238
Target Start/End: Original strand, 19465733 - 19465780
Alignment:
191 accccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||| ||||||||||||||||||||||| ||||| || ||||||||    
19465733 accccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 19465780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 195 - 238
Target Start/End: Complemental strand, 38186642 - 38186599
Alignment:
195 cacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||| ||||||||||| || ||||||||    
38186642 cacttttgtgatgatttgcacacgtgacacatgatgactgaacc 38186599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 2945736 - 2945694
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||| ||||||||||||||||||||||| ||||| |||||    
2945736 gtccctggccccacttttgtgatgatttgcacacgtggcacat 2945694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 5355009 - 5354955
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
5355009 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 5354955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 214
Target Start/End: Original strand, 6892003 - 6892033
Alignment:
184 gtccctgaccccacttttgtgatgatttgca 214  Q
    |||||||||||||||||||||||||||||||    
6892003 gtccctgaccccacttttgtgatgatttgca 6892033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 236
Target Start/End: Complemental strand, 28529150 - 28529108
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||||||||||||| ||||||||||| || ||||||    
28529150 ccacttttgtgatgatttgcacacgtgacacataatgactgaa 28529108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 35838033 - 35838075
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||| ||||||||||||||||||||| ||||| |||||    
35838033 gtccctgactccacttttgtgatgatttgcacacgtggcacat 35838075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 226
Target Start/End: Complemental strand, 37527305 - 37527271
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||||||| |||||||||||    
37527305 ccccacttttgtgatgatttgcacacgtgacacat 37527271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 39438920 - 39438878
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||| ||||||||||||||||||||| | |||||||||    
39438920 gtccctgactccacttttgtgatgatttgcacatgtgacacat 39438878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 39520507 - 39520561
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
39520507 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 39520561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 48852553 - 48852607
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| | ||||||||| || ||||||||    
48852553 gtccctggctccacttttgtgatgatttgcacatgtgacacatgatgactgaacc 48852607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 16940871 - 16940924
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||    
16940871 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaac 16940924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 11767036 - 11767080
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| ||||| ||||| || ||||||||    
11767036 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 11767080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 236
Target Start/End: Original strand, 14543799 - 14543839
Alignment:
196 acttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||||||||||| ||||||||||| || ||||||    
14543799 acttttgtgatgatttgcacacgtgacacatgatgactgaa 14543839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 132
Target Start/End: Complemental strand, 23817037 - 23817009
Alignment:
104 aaaggctaaaatatggttttagtctctgt 132  Q
    |||||||||||||||||||||||||||||    
23817037 aaaggctaaaatatggttttagtctctgt 23817009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 24954049 - 24953989
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||  ||||| ||||||| |||||||||||||| ||| ||||| || ||||||||    
24954049 aaaatagtctttgacctcacttttatgatgatttgcatatgtggcacataatgactgaacc 24953989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 30223580 - 30223624
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| ||||| ||||| || ||||||||    
30223580 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 30223624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 64; Significance: 6e-28; HSPs: 52)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 31398440 - 31398377
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31398440 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 31398377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 2616134 - 2616071
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
2616134 gaaaatagtccctgaccacacttttgtgatgatttgcatacgtgacacattataactgaaccaa 2616071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 14655669 - 14655606
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
14655669 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 14655606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 15076103 - 15076040
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
15076103 gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa 15076040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 15116773 - 15116836
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
15116773 gaaaatagtccctgtccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 15116836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 17321453 - 17321390
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
17321453 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 17321390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 17321586 - 17321523
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
17321586 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 17321523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 24273939 - 24274002
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
24273939 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 24274002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 30928944 - 30928881
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
30928944 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaa 30928881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 33801642 - 33801579
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
33801642 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 33801579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 8680877 - 8680940
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
8680877 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaa 8680940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 10091135 - 10091198
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||    
10091135 gaaaatagtccatgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa 10091198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 31166971 - 31167034
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
31166971 gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa 31167034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 34582631 - 34582694
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
34582631 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 34582694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 317911 - 317973
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||    
317911 aaaatagtctctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 317973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 26375794 - 26375856
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||    
26375794 aaaatagtccctaacctcacttttgtgatgatttgcatacgtgacacattataactgaaccaa 26375856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 179 - 240
Target Start/End: Original strand, 15962131 - 15962192
Alignment:
179 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||    
15962131 aaatagtccctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 15962192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Complemental strand, 543622 - 543562
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||    
543622 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 543562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 777939 - 777875
Alignment:
177 gaaaatagtccc-tgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
777939 gaaaatagtcccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 777875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Complemental strand, 24692880 - 24692820
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||    
24692880 gaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaac 24692820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 494661 - 494602
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||    
494661 gaaaatagtccctgaccccacttttgtgatgatctgcatacgtggcacattataactgaa 494602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 1890161 - 1890224
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||    
1890161 gaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaa 1890224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 3356400 - 3356337
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||    
3356400 gaaaatagtctctgaccccacttttgtgtttatttgcatacgtgacacattataactgaaccaa 3356337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 7155898 - 7155961
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||  ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7155898 gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 7155961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 11129302 - 11129365
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||    
11129302 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcagatgataactgaaccaa 11129365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 19296305 - 19296242
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||    
19296305 gaaaatagtccctgaccccacttttgtgatgatttacatatgtggcacattataactgaaccaa 19296242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 6468570 - 6468508
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||    
6468570 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccaa 6468508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 6591339 - 6591277
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||||    
6591339 aaaatagtgcctgactccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 6591277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 7324091 - 7324029
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||| |||||||||||||||| | |||||||||||||||||||    
7324091 aaaatagtccctgaccccacttttatgatgatttgcatacggggcacattataactgaaccaa 7324029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 32885774 - 32885837
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||| ||| ||||||||||||||||||||||||| |||||||||||||||||||    
32885774 gaaaatagtctctgcccctacttttgtgatgatttgcatacgtggcacattataactgaaccaa 32885837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 19275939 - 19275879
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
19275939 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 19275879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 21995167 - 21995227
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
21995167 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 21995227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 24901347 - 24901401
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||    
24901347 gtccctgactccacttttgtgatgatttgcacacgtgacacatgataactgaacc 24901401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 2373391 - 2373331
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||| ||||||||||||||||||||||||||||| || ||||||||    
2373391 aaaatagccgctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc 2373331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 14428751 - 14428811
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
14428751 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 14428811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 33131626 - 33131686
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||| |||| | ||||||||||||||||||||||||||||| || ||||||||    
33131626 aaaatagtccctaaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacc 33131686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 5286687 - 5286753
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgt---gacacattataactgaaccaa 240  Q
    |||||||||||||| ||||||||||||||||||||||||| ||   | |||||||||| ||||||||    
5286687 gaaaatagtccctggccccacttttgtgatgatttgcatatgtggcggcacattataaatgaaccaa 5286753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 177 - 225
Target Start/End: Original strand, 17772014 - 17772062
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacaca 225  Q
    |||||||||| ||||||||| ||||||||||||||||||||||| ||||    
17772014 gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcaca 17772062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 184 - 235
Target Start/End: Complemental strand, 25121388 - 25121337
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactga 235  Q
    ||||||| ||||||||||||||||||||||| ||||||||||| || |||||    
25121388 gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactga 25121337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 15722719 - 15722773
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||| |||||||||||| |||| ||||||| ||||||||||| |||||||||||    
15722719 gtccccgaccccacttttatgatcatttgcacacgtgacacatgataactgaacc 15722773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 238
Target Start/End: Original strand, 1214801 - 1214857
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| | | ||||||||||||||||||| ||||||||||| || ||||||||    
1214801 tagtccctggctctacttttgtgatgatttgcacacgtgacacatgatgactgaacc 1214857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 12612256 - 12612196
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||| | ||| ||||||||||||||||||||||| ||||| || ||||||||    
12612256 aaaatagtctctggctccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 12612196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 13268218 - 13268254
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtg 220  Q
    ||||||||||||||||||||||||||||||| |||||    
13268218 gtccctgaccccacttttgtgatgatttgcacacgtg 13268254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 13617648 - 13617692
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| ||||| ||||| |||||||||||    
13617648 ccacttttgtgatgatttgcacacgtggcacatgataactgaacc 13617692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 236
Target Start/End: Original strand, 11448650 - 11448701
Alignment:
189 tgaccccacttttgtgatgatttgca----tacgtgacacattataactgaa 236  Q
    |||||| |||||||||||||||||||    ||||||||||||||||||||||    
11448650 tgaccctacttttgtgatgatttgcatacgtacgtgacacattataactgaa 11448701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 12298927 - 12298969
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||| ||||||||||||||||||||||| ||||| |||||    
12298927 gtccctggccccacttttgtgatgatttgcacacgtggcacat 12298969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 14656012 - 14656066
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| |||||||||||||| |||||||| | ||||||||| || ||||||||    
14656012 gtccctggccccacttttgtgacgatttgcacatgtgacacatgatcactgaacc 14656066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 19320876 - 19320930
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
19320876 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 19320930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 30479168 - 30479222
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| ||||||||||||||| ||||||  ||||||||||| || ||||||||    
30479168 gtccctggccccacttttgtgataatttgcgcacgtgacacatgatgactgaacc 30479222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 31198724 - 31198778
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
31198724 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 31198778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 8170043 - 8169991
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||| ||||||||| ||||||||||||| ||||||||||| || |||||||    
8170043 gtccctggccccacttt-gtgatgatttgcacacgtgacacatgatgactgaac 8169991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 226
Target Start/End: Complemental strand, 3276235 - 3276203
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||||| |||||||||||    
3276235 ccacttttgtgatgatttgcacacgtgacacat 3276203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 64; Significance: 6e-28; HSPs: 79)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 13479371 - 13479434
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13479371 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 13479434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 24474861 - 24474798
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
24474861 gaaaatagtccctgaccccacttttctgatgatttgcatacgtgacacattataactgaaccaa 24474798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 41920983 - 41920920
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
41920983 gaaaatagtccctgaccctacttttgtgatgatttgcatacgtgacacattataactgaaccaa 41920920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 50714464 - 50714401
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
50714464 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 50714401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 51708926 - 51708863
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
51708926 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 51708863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 53717071 - 53717009
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
53717071 aaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 53717009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 4279233 - 4279170
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||    
4279233 gaaaatagtacctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 4279170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 6827772 - 6827709
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
6827772 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 6827709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 18136014 - 18135951
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
18136014 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 18135951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 27008306 - 27008243
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
27008306 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 27008243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 29463812 - 29463749
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||    
29463812 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataattgaaccaa 29463749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 34355065 - 34355128
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||    
34355065 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 34355128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 34362044 - 34361981
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
34362044 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 34361981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 35415401 - 35415464
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
35415401 gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 35415464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 36702101 - 36702164
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||    
36702101 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattatgactgaaccaa 36702164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 38054646 - 38054705
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
38054646 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaa 38054705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 41346117 - 41346054
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||    
41346117 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaa 41346054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 41620154 - 41620091
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
41620154 gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 41620091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 49123222 - 49123159
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
49123222 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 49123159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 55482369 - 55482306
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||    
55482369 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaa 55482306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 3178784 - 3178847
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||    
3178784 gaaaatagtccctgaccccacttttttaatgatttgcatacatgacacattataactgaaccaa 3178847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 232
Target Start/End: Complemental strand, 9446223 - 9446168
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataac 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
9446223 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgaaacattataac 9446168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 18830946 - 18831009
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||    
18830946 gaaaatagtcactggcctcacttttgtgatgatttgcatacgtgacacattataactgaaccaa 18831009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 22584509 - 22584446
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||    
22584509 gaaaatagtccatgaccccacttctgtgatgatttgcatacatgacacattataactgaaccaa 22584446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 27427944 - 27428007
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||    
27427944 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacaatataactaaaccaa 27428007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 32208642 - 32208705
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||    
32208642 gaaaatagtccctgaccctacttttgtgattatttgtatacgtgacacattataactgaaccaa 32208705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 52017768 - 52017705
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||    
52017768 gaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaa 52017705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 55072492 - 55072554
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||    
55072492 aaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaa 55072554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 13064260 - 13064313
Alignment:
179 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataac 232  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||    
13064260 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataac 13064313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 123793 - 123730
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| |||| ||||||||| ||||||||||||||| |||||||||||||||||||    
123793 gaaaatagtccctaaccctacttttgtggtgatttgcatacgtggcacattataactgaaccaa 123730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 179 - 240
Target Start/End: Complemental strand, 16712590 - 16712529
Alignment:
179 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||| ||||||||||||||||||||||| ||| |||||||||||| ||||||    
16712590 aaatagtccctgacgccacttttgtgatgatttgcatatgtggcacattataacttaaccaa 16712529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 2180471 - 2180411
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| |||||||||||||||||||||||| |||| || ||||||||    
2180471 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgagacatgatgactgaacc 2180411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 18205256 - 18205316
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||  ||||||||||||||||||||||||||||||||| |||||||| ||||||    
18205256 gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgatacattatagctgaac 18205316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 46087860 - 46087921
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||| |||| |||||||||||||||||||||||  ||||||||||||||||||    
46087860 gaaaatagtccctgatcccatttttgtgatgatttgcatacgtg--acattataactgaaccaa 46087921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 5063105 - 5063164
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||| |||||||||||||||||||||||||||| ||| ||| |||||||||||    
5063105 gaaaatagtccttgaccccacttttgtgatgatttgcatatgtggcacgttataactgaa 5063164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35763853 - 35763790
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| |||||| |||||||||||||| |||||||  |||||||||||||||||||    
35763853 gaaaatagtcccttaccccaattttgtgatgatttacatacgtagcacattataactgaaccaa 35763790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 22099809 - 22099749
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
22099809 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 22099749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 182 - 238
Target Start/End: Complemental strand, 45505786 - 45505730
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
45505786 tagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 45505730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 45593328 - 45593387
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
45593328 aaaatagtccctgacccca-ttttgtgatgatttgcatacgtggcacatgatgactgaacc 45593387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 50822178 - 50822134
Alignment:
196 acttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||| |||||||||||||||||||    
50822178 acttttgtgatgatttgcatacgtggcacattataactgaaccaa 50822134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 51545868 - 51545808
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||| |||| ||||||||||||||||||||||| ||||| || ||||||||    
51545868 aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 51545808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 11692870 - 11692924
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||||||||||| |||||||| ||||| || ||||||||    
11692870 gtccctgaccccacttttgtgatgattttcatacgtggcacatgatgactgaacc 11692924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 12791865 - 12791811
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||| |||||||||||||||||||| ||||||||||| || ||||||||    
12791865 gtccctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc 12791811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 7642544 - 7642491
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||||||||||||||||||||||| ||||| ||||| || |||||||    
7642544 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 7642491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 32365196 - 32365244
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||| ||||| ||||||||||||||||||||||| |||||    
32365196 aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacat 32365244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 189 - 233
Target Start/End: Original strand, 52429825 - 52429869
Alignment:
189 tgaccccacttttgtgatgatttgcatacgtgacacattataact 233  Q
    |||||||| ||||||||||||||||||||||| ||||||||||||    
52429825 tgaccccatttttgtgatgatttgcatacgtggcacattataact 52429869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 52441862 - 52441922
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||  |||||||| ||||||||||||||||||||||||||| | || ||||||||    
52441862 aaaatagtctttgaccccatttttgtgatgatttgcatacgtgacacgtgatgactgaacc 52441922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 5797711 - 5797657
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||||    
5797711 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 5797657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 5827764 - 5827806
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||||||||||||||||| ||| |||||    
5827764 gtccctgaccccacttttgtgatgatttgcatatgtggcacat 5827806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 9289368 - 9289427
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| |||||| |||||||||||||||||||     |||||||||||||||||||    
9289368 gaaaatagtcccttaccccaattttgtgatgatttgcata----gcacattataactgaaccaa 9289427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 13530488 - 13530542
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||||    
13530488 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 13530542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 224
Target Start/End: Complemental strand, 14791759 - 14791717
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacac 224  Q
    ||||||||||||||||||||||||||||||||| || ||||||    
14791759 tagtccctgaccccacttttgtgatgatttgcacacttgacac 14791717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 25424203 - 25424149
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||||    
25424203 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 25424149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 46292441 - 46292483
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||| ||||||||||||||||||||||| |||||||||||    
46292441 gtccctgcccccacttttgtgatgatttgcacacgtgacacat 46292483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 25358460 - 25358407
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||||||||||||||||||||| | ||||| ||||| || |||||||    
25358460 gtccctgaccccacttttgtgatgatttgaacacgtggcacatgatgactgaac 25358407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 29420436 - 29420387
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||| || ||||||||||||||||||| |||||||||| |||||    
29420436 gaaaatagtctctaaccccacttttgtgatgatatgcatacgtggcacat 29420387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 50754146 - 50754094
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||||||||||||||||| || ||||||||||| || |||||||    
50754146 gtccctgaccccacttttgtgatgattt-cacacgtgacacatgatgactgaac 50754094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 51738362 - 51738309
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||    
51738362 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaac 51738309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 102
Target Start/End: Complemental strand, 10078308 - 10078252
Alignment:
46 atagggaaatataattatttagaggatatattatttgctttatatgatatgaaacat 102  Q
    ||||||| ||| | |||||||| ||||||| ||||| ||||||||||||||||||||    
10078308 atagggagataaagttatttaggggatatactattttctttatatgatatgaaacat 10078252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 239
Target Start/End: Original strand, 19321682 - 19321734
Alignment:
187 cctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    |||||| ||||||||||||| ||||||| ||||||||||| || |||||||||    
19321682 cctgactccacttttgtgataatttgcacacgtgacacatgatgactgaacca 19321734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 236
Target Start/End: Complemental strand, 54903359 - 54903315
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||||||||||||||||||||||  |||||||||| |||||||||    
54903359 ccccacttttgtgatgatttgcaagcgtgacacataataactgaa 54903315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 217
Target Start/End: Original strand, 11285605 - 11285644
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatac 217  Q
    ||||||||| ||||||||| ||||||||||||||||||||    
11285605 aaaatagtctctgaccccatttttgtgatgatttgcatac 11285644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 239
Target Start/End: Complemental strand, 42848282 - 42848227
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    ||||||||| ||||||||||||| ||||||| ||||| ||||| || |||||||||    
42848282 gtccctgactccacttttgtgataatttgcacacgtgtcacatgatgactgaacca 42848227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 239
Target Start/End: Original strand, 47135887 - 47135942
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||||    
47135887 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacca 47135942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 4211610 - 4211652
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||| ||||||||||||||||||||||| ||||| |||||    
4211610 gtccctggccccacttttgtgatgatttgcacacgtggcacat 4211652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 226
Target Start/End: Complemental strand, 20292205 - 20292167
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||| ||||||||||||||||||||| |||||||||||    
20292205 ctgactccacttttgtgatgatttgcacacgtgacacat 20292167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 24774318 - 24774264
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
24774318 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 24774264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 226
Target Start/End: Original strand, 31182238 - 31182276
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||||| |||||||||| |||||||||||    
31182238 ctgaccccacttttgtaatgatttgcacacgtgacacat 31182276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 31812032 - 31812086
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | |||||||| |||||||||||| ||||||||||| || ||||||||    
31812032 gtccctggctccacttttatgatgatttgcacacgtgacacatgatgactgaacc 31812086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 36050395 - 36050449
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| ||||||||||||||||||||||| ||||| || || || ||||||||    
36050395 gtccctggccccacttttgtgatgatttgcacacgtggcatatgatgactgaacc 36050449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 51763093 - 51763039
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| |||||||| || || ||||||||    
51763093 gtccctggctccacttttgtgatgatttgcacacgtgacaaatgatgactgaacc 51763039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 54208716 - 54208662
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
54208716 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 54208662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 220
Target Start/End: Complemental strand, 8191288 - 8191244
Alignment:
178 aaaatagtccctgaccccacttt--tgtgatgatttgcatacgtg 220  Q
    ||||||||||||||||||||| |  ||||||||||||||||||||    
8191288 aaaatagtccctgaccccactatattgtgatgatttgcatacgtg 8191244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 14488078 - 14488025
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||| ||| ||||||||||||||||| ||||| ||||| || |||||||    
14488078 gtccctgacaccaattttgtgatgatttgcacacgtggcacatgatgactgaac 14488025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 238
Target Start/End: Original strand, 41439902 - 41439951
Alignment:
189 tgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||| ||||||||||||||||||| ||||| ||||| || ||||||||    
41439902 tgaccctacttttgtgatgatttgcacacgtggcacatgatgactgaacc 41439951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Complemental strand, 5203174 - 5203130
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| | ||||||||| || ||||||||    
5203174 ccacttttgtgatgatttgcacatgtgacacatgatgactgaacc 5203130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 29380717 - 29380769
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||| |||||||||||| |||||||||| ||||| ||||| || ||||||    
29380717 gtccctggccccacttttgtaatgatttgcacacgtggcacatgatgactgaa 29380769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 43368566 - 43368614
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||  |||||||| |||| |||||||||||||||||| |||||    
43368566 aaaatagtcgttgaccccatttttatgatgatttgcatacgtggcacat 43368614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 52543620 - 52543568
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||| ||||||||||||| |||||||||||| ||||| ||||| || ||||||    
52543620 gtccatgaccccacttttctgatgatttgcacacgtgtcacatgatgactgaa 52543568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 64; Significance: 6e-28; HSPs: 89)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 275543 - 275606
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
275543 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 275606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 20907356 - 20907293
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20907356 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 20907293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 39288798 - 39288735
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39288798 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 39288735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 12673904 - 12673841
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
12673904 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 12673841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 13584105 - 13584168
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
13584105 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 13584168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 16123242 - 16123305
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
16123242 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 16123305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 19656802 - 19656739
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
19656802 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 19656739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 22156031 - 22156094
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
22156031 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 22156094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 26799990 - 26800053
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
26799990 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 26800053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 30004554 - 30004617
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
30004554 gaaaatagtccctgaccccacttttgtgatgatttgcatgcgtgacacattataactgaaccaa 30004617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 37506968 - 37507031
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
37506968 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 37507031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 45161213 - 45161276
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
45161213 gaaaatagtccctgacaccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 45161276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 45320879 - 45320816
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
45320879 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa 45320816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 29446057 - 29446119
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
29446057 aaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 29446119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 3152010 - 3151947
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
3152010 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 3151947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 4950266 - 4950203
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
4950266 gaaaataggccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 4950203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 8510316 - 8510379
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
8510316 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 8510379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 10977079 - 10977142
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
10977079 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaa 10977142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 20757500 - 20757563
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
20757500 gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa 20757563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 21159715 - 21159652
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
21159715 gaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 21159652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 29955400 - 29955463
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||    
29955400 gaaaatagtccctgaccccacttttgtgatgatttgcattcgtgtcacattataactgaaccaa 29955463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 39072112 - 39072049
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
39072112 gaaaatagtccctgaccccacttttgtgataatttgcatacgtggcacattataactgaaccaa 39072049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 39437007 - 39436944
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||    
39437007 gaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaa 39436944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 51834841 - 51834778
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||    
51834841 gaaaatagtccctgaccccactattgtgatgatttgcatacgtgacacattataacggaaccaa 51834778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 5345587 - 5345525
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
5345587 aaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 5345525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 179 - 237
Target Start/End: Complemental strand, 20612796 - 20612738
Alignment:
179 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
20612796 aaatagcccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 20612738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 47901901 - 47901963
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||    
47901901 gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaacca 47901963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 7518346 - 7518287
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||    
7518346 gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattataactgaa 7518287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 10778631 - 10778568
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||    
10778631 gaaaatagtccctgaccctacttttgtgatgatttgcatatgtggcacattataactgaaccaa 10778568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 14633786 - 14633723
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||    
14633786 gaaaatagtccctaaccccacttttgtgaagatttgcatacgtggcacattataactgaaccaa 14633723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 28427507 - 28427444
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||    
28427507 gaaaatagtctctgaccccacttttgtgatgatttgcatacatggcacattataactgaaccaa 28427444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 30130258 - 30130321
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||    
30130258 gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattatagctgaaccaa 30130321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 34238699 - 34238762
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||    
34238699 gaaaatagtccctgactccacttttgagatgatttgcatacgtggcacattataactgaaccaa 34238762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 40169552 - 40169493
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||    
40169552 gaaaatagtccctgaccccacttttgtgatgattcgcatacgtggcacattataactgaa 40169493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 189 - 240
Target Start/End: Complemental strand, 49670725 - 49670674
Alignment:
189 tgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
49670725 tgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 49670674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 9863303 - 9863239
Alignment:
177 gaaaatagtccctgaccccactttt-gtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||    
9863303 gaaaatagtccctgacaccactttttgtgatgatttgcatacgtgacacattataattgaaccaa 9863239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 18175889 - 18175951
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||  | ||||||||||||||||||||||| |||||||||||||||||||    
18175889 aaaatagtccctgaccttatttttgtgatgatttgcatacgtggcacattataactgaaccaa 18175951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 3830232 - 3830292
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||    
3830232 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaac 3830292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 4513519 - 4513459
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
4513519 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 4513459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 30268585 - 30268645
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||| |||||||||| ||||||||||||||||||||||||||||| || ||||||||    
30268585 aaaatagttcctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc 30268645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 51500584 - 51500536
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||    
51500584 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacat 51500536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 25710771 - 25710708
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||| |||||||||||||||| || ||||||| |||||||||||||||||||    
25710771 gaaaatagtctctgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaa 25710708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 31869856 - 31869793
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| |||| |||||||||||||||| || ||||||| |||||||||||||||||||    
31869856 gaaaatagtccatgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaa 31869793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 30426175 - 30426121
Alignment:
186 ccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||    
30426175 ccctgaccccatttttgtgatgatttgcatatgtgacacattataactaaaccaa 30426121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 45521650 - 45521712
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    |||||||||| || | |||| |||| |||||||||||||||||||||||||||||||||||||    
45521650 gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaacca 45521712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 46186669 - 46186620
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||    
46186669 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat 46186620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 7957118 - 7957062
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||| ||||| ||||| || ||||||||||    
7957118 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaa 7957062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 15016645 - 15016597
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||    
15016645 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat 15016597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 51759922 - 51759970
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||    
51759922 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat 51759970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 50261839 - 50261777
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||| |||||||||||||||||||||| | || |||||||||||||||||||    
50261839 gaaaatagtctctgactccacttttgtgatgatttgcatgc-tggcacattataactgaaccaa 50261777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 20405110 - 20405060
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||| ||||||||||||||||||||||||||||||||| || ||||||||    
20405110 ctgactccacttttgtgatgatttgcatacgtgacacatgatgactgaacc 20405060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 40277931 - 40277985
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||||||| ||||| ||||| || ||||||||    
40277931 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 40277985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 195 - 237
Target Start/End: Original strand, 40979479 - 40979521
Alignment:
195 cacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||||||||||||||| ||||||||||||||||    
40979479 cacttttgtgatgatttgcatacgtgtcacattataactgaac 40979521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 179 - 237
Target Start/End: Original strand, 50196401 - 50196459
Alignment:
179 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||||| | ||||||||||||||||||||||| ||||| || |||||||    
50196401 aaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaac 50196459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 4814799 - 4814751
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||||| || ||||||||||||||||||||||| |||||    
4814799 aaaatagtccctgacctcatttttgtgatgatttgcatacgtggcacat 4814751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 28942627 - 28942674
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacaca 225  Q
    ||||||||| |||| |||||||||||||||||||||||||||| ||||    
28942627 aaaatagtctctgatcccacttttgtgatgatttgcatacgtggcaca 28942674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 237
Target Start/End: Original strand, 46901203 - 46901261
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||| ||||||||||| || |||| |||||||||||||||||||||||| ||||||||||    
46901203 aaaaaagtccctgacctcattttt-tgatgatttgcatacgtgacacatgataactgaac 46901261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 4034826 - 4034880
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||||    
4034826 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 4034880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 9262045 - 9261991
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||||    
9262045 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 9261991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 36673072 - 36673114
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||||||||||||||||| |||||||| |||||    
36673072 gtccctgaccccacttttgtgatgatttacatacgtggcacat 36673114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 45005995 - 45006049
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
45005995 gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 45006049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 47114701 - 47114651
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||| |||||||||||||||||||| ||||||||||| || ||||||||    
47114701 ctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc 47114651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 53701461 - 53701523
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||| || || |||||| ||||||||||||||||||||||| ||||| || ||||||||||    
53701461 aaaataatctctaaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaa 53701523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 238
Target Start/End: Original strand, 54767284 - 54767334
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||  ||||||||||| || ||||||||    
54767284 ctgaccccacttttgtgatgatttgctcacgtgacacatgatgactgaacc 54767334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 225
Target Start/End: Complemental strand, 8555199 - 8555158
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacaca 225  Q
    ||||||||||||||||||||||||||||||| ||||| ||||    
8555199 gtccctgaccccacttttgtgatgatttgcacacgtgtcaca 8555158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 9603738 - 9603791
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||    
9603738 gtccctgactccacttttgtgatgatttgcacacgtgtcacatgatgactgaac 9603791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 185 - 238
Target Start/End: Complemental strand, 38232498 - 38232445
Alignment:
185 tccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| |||||||||||||||||| | ||||||||||| || ||||||||    
38232498 tccctgacctcacttttgtgatgatttgtacacgtgacacatgatgactgaacc 38232445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 39132798 - 39132745
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||| ||||||||||||||||||||||| ||||||| ||| || |||||||    
39132798 gtccctggccccacttttgtgatgatttgcacacgtgacgcatgatgactgaac 39132745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 15286402 - 15286354
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||| |||| |||| ||||||||||||||||||||||| |||||    
15286402 aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacat 15286354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 30552246 - 30552306
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||| | |||| |||||||||||||||||| ||||| || ||||||||    
30552246 aaaatagtcactgaccctatttttatgatgatttgcatacgtggcacatgatgactgaacc 30552306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 237
Target Start/End: Original strand, 51058703 - 51058751
Alignment:
189 tgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||| ||||||||||||||||||||||| ||||||||| || |||||||    
51058703 tgactccacttttgtgatgatttgcatatgtgacacatgatgactgaac 51058751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 52342473 - 52342421
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||    
52342473 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaa 52342421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 223
Target Start/End: Original strand, 27681426 - 27681465
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgaca 223  Q
    |||||||| |||||||||||||||||||||| ||||||||    
27681426 gtccctgatcccacttttgtgatgatttgcacacgtgaca 27681465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 36732750 - 36732801
Alignment:
187 cctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||||||||||| | ||| ||||| || ||||||||    
36732750 cctgaccccacttttgtgatgatttgcacatgtggcacatgatgactgaacc 36732801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 179 - 238
Target Start/End: Complemental strand, 45313759 - 45313700
Alignment:
179 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||| ||||||||||||||||||||| ||| ||| | ||| || ||||||||    
45313759 aaatagtccctggccccacttttgtgatgatttgtatatgtggcgcatgatgactgaacc 45313700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 2486785 - 2486739
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||| ||||| ||||| || ||||||||    
2486785 ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 2486739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 9596986 - 9596932
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||| ||||||||||||||||| ||||| || ||||||||    
9596986 gtccctgtctccacttttgagatgatttgcatacgtggcacatgatgactgaacc 9596932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 240
Target Start/End: Complemental strand, 30034353 - 30034307
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||| ||||| ||||| || ||||||||||    
30034353 ccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaa 30034307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 191 - 237
Target Start/End: Original strand, 35533393 - 35533439
Alignment:
191 accccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||||||||||||| ||||| ||||| || |||||||    
35533393 accccacttttgtgatgatttgcacacgtggcacatgatgactgaac 35533439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 50009029 - 50009071
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||| |||||||||||||||||||||||||| ||||| |||||    
50009029 gtccatgaccccacttttgtgatgatttgcacacgtggcacat 50009071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 52956591 - 52956537
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | |||||||||||||||||| || ||||||||||| || ||||||||    
52956591 gtccctggctccacttttgtgatgatttacacacgtgacacatgatgactgaacc 52956537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 238
Target Start/End: Original strand, 53113496 - 53113546
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||| || || ||||| || ||||||||    
53113496 ctgaccccacttttgtgatgatttgcacacatggcacatgatgactgaacc 53113546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 236
Target Start/End: Original strand, 28418653 - 28418702
Alignment:
187 cctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||| ||||||||||||||||||||||| ||||| ||||| || ||||||    
28418653 cctggccccacttttgtgatgatttgcacacgtggcacatgatgactgaa 28418702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 193 - 238
Target Start/End: Complemental strand, 44802496 - 44802451
Alignment:
193 cccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||||| || |||||||| || ||||||||    
44802496 cccacttttgtgatgatttgcacacatgacacataatgactgaacc 44802451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 182 - 238
Target Start/End: Complemental strand, 16679857 - 16679801
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||| || ||||||||||||||||| ||||| ||||  || ||||||||    
16679857 tagtccctgacctcatttttgtgatgatttgcacacgtggcacaagatgactgaacc 16679801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 35177374 - 35177418
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| ||||| ||||| || ||||||||    
35177374 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 35177418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 35565627 - 35565671
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| ||||| ||||| || ||||||||    
35565627 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 35565671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 198 - 238
Target Start/End: Original strand, 43440614 - 43440654
Alignment:
198 ttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||| ||||| || ||||||||    
43440614 ttttgtgatgatttgcatacgtggcacatgatgactgaacc 43440654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 188 - 236
Target Start/End: Complemental strand, 53719214 - 53719166
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||||| |||||||||||||||||||| |||||| |||| || ||||||    
53719214 ctgacctcacttttgtgatgatttgcacacgtgatacatgatgactgaa 53719166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 64; Significance: 6e-28; HSPs: 80)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 3679725 - 3679788
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3679725 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 3679788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 15335193 - 15335130
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15335193 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 15335130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 31258441 - 31258504
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31258441 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 31258504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 990188 - 990251
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
990188 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 990251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 2733285 - 2733348
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2733285 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 2733348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 12361112 - 12361175
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
12361112 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 12361175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 13260087 - 13260150
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
13260087 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 13260150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 18473373 - 18473436
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
18473373 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 18473436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 19622757 - 19622820
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
19622757 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 19622820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 32454189 - 32454126
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
32454189 gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa 32454126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 41358562 - 41358499
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
41358562 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 41358499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 45290559 - 45290621
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
45290559 aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 45290621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 4323930 - 4323993
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||    
4323930 gaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaa 4323993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 7001795 - 7001732
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
7001795 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaa 7001732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 17984595 - 17984532
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||    
17984595 gaaaatagttcatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 17984532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 21391276 - 21391214
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
21391276 gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactgaaccaa 21391214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 32728948 - 32728885
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
32728948 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 32728885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 48955964 - 48955901
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
48955964 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 48955901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 24649452 - 24649514
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
24649452 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 24649514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 178 - 239
Target Start/End: Complemental strand, 29688330 - 29688269
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||    
29688330 aaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 29688269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 14007588 - 14007647
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||    
14007588 gaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaa 14007647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 32626792 - 32626729
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||    
32626792 gaaaatagtccctgaccccacttttgtgatgatttacatacgtggcacaatataactgaaccaa 32626729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 34383047 - 34383110
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||    
34383047 gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaa 34383110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35308009 - 35307946
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||    
35308009 gaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaa 35307946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 41881195 - 41881258
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||||    
41881195 gaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataacttaaccaa 41881258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 44641333 - 44641271
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||    
44641333 gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtggcacattataactgaaccaa 44641271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 18302281 - 18302219
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
18302281 aaaatagtctctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 18302219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 177 - 239
Target Start/End: Complemental strand, 50429108 - 50429047
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    |||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||    
50429108 gaaaatagtccctgaccccacttt-gtgatgatttgcttacgtgacacattataactgaacca 50429047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 46868329 - 46868389
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
46868329 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc 46868389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1159739 - 1159676
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||| |||||||||||||| ||| ||| |||||||||||||||    
1159739 gaaaatagtccctgaccccacttttatgatgatttgcatatgtggcacgttataactgaaccaa 1159676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 10552212 - 10552149
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||  ||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
10552212 gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaa 10552149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 21383203 - 21383266
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| |||||||||||||||| ||||||||| ||| |||||||||||||||||||    
21383203 gaaaatagtccctaaccccacttttgtgattatttgcatatgtggcacattataactgaaccaa 21383266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 26062058 - 26062117
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||    
26062058 gaaaatagtacatgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 26062117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 4360370 - 4360432
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| |||||||||| ||||||||||||||| | |||||||||||||||||    
4360370 aaaatagtccctgaccgcacttttgtgctgatttgcatacgtggcgcattataactgaaccaa 4360432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 182 - 240
Target Start/End: Original strand, 35005491 - 35005549
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||    
35005491 tagtccctgaccctagttttgtgatgatttgcatacgtggcacattataactgaaccaa 35005549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 1811170 - 1811109
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||| ||| ||||||||||||||||||||||||||||| || ||||||||    
1811170 gaaaatagtccctgactccatttttgtgatgatttgcatacgtgacacatgatgactgaacc 1811109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 22919783 - 22919844
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
22919783 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 22919844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 26191459 - 26191520
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
26191459 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 26191520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 18900033 - 18899973
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
18900033 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 18899973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 26442797 - 26442736
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||  || ||||||||||||||||||||||| |||||||||||||||||||||||    
26442797 gaaaatagtccc--acaccacttttgtgatgatttgcatatgtgacacattataactgaaccaa 26442736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 33067629 - 33067569
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||| |||||||||||||||||||||| ||||| || ||||||||    
33067629 aaaatagtccctgaccccacctttgtgatgatttgcatacgtggcacatgatgactgaacc 33067569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 7819001 - 7818938
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||  | | ||||||||||||||||||||| |||||||||||||||||||    
7819001 gaaaatagtccctgaccatattcttgtgatgatttgcatacgtggcacattataactgaaccaa 7818938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 33379989 - 33380051
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || || |||||||    
33379989 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgaccgaaccaa 33380051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 48730509 - 48730455
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || ||||||||    
48730509 gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 48730455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 8364867 - 8364814
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || |||||||    
8364867 gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaac 8364814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 13770590 - 13770639
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||    
13770590 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat 13770639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 179 - 240
Target Start/End: Complemental strand, 22953454 - 22953393
Alignment:
179 aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||| ||| |||||||||||||||| ||||||||||| ||||||||| ||||||    
22953454 aaatagtccctggccctacttttgtgatgatttacatacgtgacatattataacttaaccaa 22953393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 16083154 - 16083214
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||| ||||| ||||||||||||||||||||||| ||||| || ||||||||    
16083154 aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 16083214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 11822104 - 11822165
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||| ||||| ||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
11822104 gaaagtagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 11822165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 20756120 - 20756169
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||||||| | ||||||||||||||||||||||| |||||    
20756120 gaaaatagtccctgaccctatttttgtgatgatttgcatacgtggcacat 20756169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 26142521 - 26142557
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgc 213  Q
    |||||||||||||||||||||||||||||||||||||    
26142521 gaaaatagtccctgaccccacttttgtgatgatttgc 26142557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 34808296 - 34808356
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||  |||||||| ||||||||||||||||||||||| ||||| || ||||||||    
34808296 aaaatagtcaatgaccccatttttgtgatgatttgcatacgtggcacataatgactgaacc 34808356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 37545850 - 37545790
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||| ||||||| ||||||||| ||||||||||||| ||||| || ||||||||    
37545850 aaaatagtccccgaccccatttttgtgataatttgcatacgtgccacatgatgactgaacc 37545790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 48609493 - 48609445
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||| ||||||||| ||||||||||||||||||||||| |||||    
48609493 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacat 48609445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 52254283 - 52254343
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| |||| | |||||||||||||||| ||||| || ||||||||    
52254283 aaaatagtccctgaccccatttttattatgatttgcatacgtggcacatgatgactgaacc 52254343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 29072600 - 29072647
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacaca 225  Q
    ||||||||||||||||||| ||||||||||||| ||||||||| ||||    
29072600 aaaatagtccctgaccccatttttgtgatgattcgcatacgtggcaca 29072647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 45368749 - 45368702
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacaca 225  Q
    ||||||||||||||||||| ||||||||||||||||||| ||| ||||    
45368749 aaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcaca 45368702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 201 - 240
Target Start/End: Original strand, 49226361 - 49226400
Alignment:
201 tgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||| |||||||||||||||||||    
49226361 tgtgatgatttgcatacgtggcacattataactgaaccaa 49226400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 19198836 - 19198786
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||| ||||| ||||| ||||| |||||    
19198836 ctgaccccacttttgtgatgatttgcacacgtggcacatgataacggaacc 19198786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 24510051 - 24510105
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||||||| | ||| ||||| || ||||||||    
24510051 gtccctgaccccacttttgtgatgatttgcagatgtggcacatgatgactgaacc 24510105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 189 - 239
Target Start/End: Complemental strand, 42483217 - 42483167
Alignment:
189 tgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    |||||||||||||||||||||||||| ||||| ||||| || |||||||||    
42483217 tgaccccacttttgtgatgatttgcacacgtgtcacatgatgactgaacca 42483167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 49073944 - 49073902
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||||||||||||||| ||||| |||||    
49073944 gtccctgaccccacttttgtgatgatttgcacacgtgtcacat 49073902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 188 - 240
Target Start/End: Original strand, 18927890 - 18927942
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||| || ||||| ||||| || ||||||||||    
18927890 ctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaaccaa 18927942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 27521676 - 27521724
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||| | || ||||||||||||||||||||||| |||||    
27521676 aaaatagtccctgatctcatttttgtgatgatttgcatacgtggcacat 27521724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 236
Target Start/End: Complemental strand, 51986459 - 51986415
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||||||||||||||| ||||||||||| || ||||||    
51986459 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaa 51986415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 292959 - 293002
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtg 220  Q
    ||||||||||| |  |||||||||||||||||||||||||||||    
292959 gaaaatagtccatagccccacttttgtgatgatttgcatacgtg 293002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 239
Target Start/End: Complemental strand, 10631419 - 10631364
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    ||||||||| ||||||||||||| ||||||| ||||| ||||| || |||||||||    
10631419 gtccctgactccacttttgtgataatttgcacacgtgtcacatgatgactgaacca 10631364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 235
Target Start/End: Complemental strand, 26324838 - 26324787
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactga 235  Q
    ||||||||||||||||||||||||||||||| || || ||||| || |||||    
26324838 gtccctgaccccacttttgtgatgatttgcacacatgtcacataatgactga 26324787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 220
Target Start/End: Original strand, 3753312 - 3753354
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtg 220  Q
    ||||| |||| |||||||| |||||||||||||||||||||||    
3753312 aaaatggtccttgaccccatttttgtgatgatttgcatacgtg 3753354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 4789417 - 4789471
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||||||||  | ||||| ||||| || ||||||||    
4789417 gtccctgaccccacttttgtgatgatttaaacacgtggcacatgatgactgaacc 4789471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 10887342 - 10887396
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
10887342 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 10887396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 214
Target Start/End: Original strand, 12360712 - 12360742
Alignment:
184 gtccctgaccccacttttgtgatgatttgca 214  Q
    |||||||||||||||||||||||||||||||    
12360712 gtccctgaccccacttttgtgatgatttgca 12360742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 16060704 - 16060758
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
16060704 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 16060758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 17129975 - 17129921
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||| || || || ||||||||    
17129975 gtccctgactccacttttgtgatgatttgcacacgtggcagatgatgactgaacc 17129921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 18079516 - 18079562
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||| ||||| ||||| || ||||||||    
18079516 ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 18079562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 32035678 - 32035632
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| | ||||||||||| || ||||||||    
32035678 ccccacttttgtgatgatttgtacacgtgacacatgatgactgaacc 32035632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 220
Target Start/End: Original strand, 32420208 - 32420242
Alignment:
186 ccctgaccccacttttgtgatgatttgcatacgtg 220  Q
    ||||||||||||||||||||||||||||| |||||    
32420208 ccctgaccccacttttgtgatgatttgcacacgtg 32420242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 188 - 240
Target Start/End: Original strand, 12322718 - 12322770
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||| |||||||||||| | ||| ||||| |||| ||||||||    
12322718 ctgaccccacttttatgatgatttgcacatgtggcacatgataattgaaccaa 12322770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 19720965 - 19720913
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||| ||||||||||||| ||||||| ||||| ||||| || ||||||    
19720965 gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaa 19720913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 24977898 - 24977942
Alignment:
194 ccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||| ||||| ||||| || ||||||||    
24977898 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 24977942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 72)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 38731929 - 38731991
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38731929 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 38731991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 8046430 - 8046493
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
8046430 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 8046493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 19183884 - 19183947
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
19183884 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 19183947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 23989937 - 23990000
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
23989937 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 23990000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 26814127 - 26814064
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
26814127 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 26814064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 38980152 - 38980089
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
38980152 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 38980089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 41693901 - 41693838
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
41693901 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattacaactgaaccaa 41693838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 41791119 - 41791178
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41791119 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 41791178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 44985722 - 44985785
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
44985722 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacgttataactgaaccaa 44985785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 3838162 - 3838099
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
3838162 gaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 3838099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 5790797 - 5790734
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
5790797 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 5790734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 7814505 - 7814442
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7814505 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaa 7814442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 7814638 - 7814575
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7814638 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaa 7814575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 24483632 - 24483695
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
24483632 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 24483695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 37272001 - 37271938
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
37272001 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 37271938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 40302077 - 40302140
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
40302077 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactcaaccaa 40302140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 40786561 - 40786624
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||    
40786561 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa 40786624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 17541674 - 17541612
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
17541674 aaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 17541612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 16899996 - 16900056
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||    
16899996 gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 16900056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 16993387 - 16993447
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||    
16993387 gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 16993447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 26707972 - 26708032
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
26707972 gaaaatagtccctgaatccacttttgtgatgatttgcatacgtgacacattataactgaac 26708032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 43710480 - 43710540
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||    
43710480 gaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaac 43710540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 12835427 - 12835490
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||    
12835427 gaaaatagtccctgaccctacttttgtgatgatttgcatacgtggcacattataacggaaccaa 12835490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 22881869 - 22881806
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||    
22881869 gaaaatagtccctaaccccacttttgtgatgatttgcatacgtgtcacattataactaaaccaa 22881806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 25954325 - 25954262
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||    
25954325 gaaaatagtccctaactccacttttgtgatgatttgcatacgtaacacattataactgaaccaa 25954262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 26238912 - 26238975
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||||    
26238912 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacataataactgaaccaa 26238975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 31225817 - 31225879
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||    
31225817 gaaaatagtccttgaccccacttttgtgatgatttgca-acgtgacacattataactgaaccaa 31225879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 43789090 - 43789027
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||    
43789090 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcatattatcactgaaccaa 43789027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 44073705 - 44073642
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||    
44073705 gaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaa 44073642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 24483500 - 24483562
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
24483500 aaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacatgataactgaaccaa 24483562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 43597400 - 43597339
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
43597400 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc 43597339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 177 - 237
Target Start/End: Complemental strand, 14393029 - 14392969
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||    
14393029 gaaaatagtccctgaccccacttttgtgatgatttgtatatgtggcacattataactgaac 14392969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 17912550 - 17912614
Alignment:
177 gaaaatagtccctgaccccacttttgtgat-gatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||    
17912550 gaaaatagtccctgaccccacttttgtgatagacttgcatacgggacacattataactgaaccaa 17912614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 20658160 - 20658223
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||| |||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||    
20658160 gaaaataatccctgactccacttttgtgattatttgcatacgtggcacattataactgaaccaa 20658223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 33732960 - 33733023
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||| |||||||| |||||| |||||||||||||||||| |||||||||||||||||||    
33732960 gaaaatagttcctgaccctacttttatgatgatttgcatacgtggcacattataactgaaccaa 33733023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1497843 - 1497780
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||   ||||||||||||||||||||||||||||||  ||||||||||||||||||    
1497843 gaaaatagtccacaaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaa 1497780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 10665084 - 10665143
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||||||||| |||||||||||||||||||||||| ||||||||  ||||||||||||||    
10665084 gaaaatagtctctgaccccacttttgtgatgatttacatacgtggtacattataactgaa 10665143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 11713743 - 11713680
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||| ||||||||| ||||||||||||||| |||||||||| ||| ||||    
11713743 gaaaatagtccctgacccaacttttgtggtgatttgcatacgtggcacattataattgagccaa 11713680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 177 - 239
Target Start/End: Complemental strand, 19831694 - 19831632
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca 239  Q
    |||||||||| || | |||| |||| |||||||||||||||||||||||||||||||||||||    
19831694 gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaacca 19831632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 43592146 - 43592195
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||    
43592146 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat 43592195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 12820967 - 12820892
Alignment:
29 aatagtggcagttacata--tagggaaatataattatttagaggatatattatttgctttatatgatatgaaacat 102  Q
    ||||||||||||||||||  |||||| ||||| |||||||| ||||||| ||||| ||| ||||||||||||||||    
12820967 aatagtggcagttacataaatagggagatatagttatttaggggatatactattttcttcatatgatatgaaacat 12820892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 45442415 - 45442475
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||| ||||||||| ||||||||||||| ||||| || ||||||||    
45442415 aaaatagtccctgaccccatttttgtgattatttgcatacgtggcacatgatgactgaacc 45442475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 29865411 - 29865348
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| || |||  |||||||||||||||||||||||||||||||||  ||||||||||    
29865411 gaaaatagtctctaaccaaacttttgtgatgatttgcatacgtgacacattaatactgaaccaa 29865348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 31909370 - 31909316
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| ||||||||||||||||||||||| ||||||||||| || ||||||||    
31909370 gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 31909316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 32691413 - 32691474
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||| ||||||||||||| ||||||||||||||||||||||| ||| | || ||||||||    
32691413 gaaaatggtccctgaccccatttttgtgatgatttgcatacgtggcacgtgatgactgaacc 32691474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 31326149 - 31326101
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||| ||||||||| ||||||||||||||||||||||| |||||    
31326149 aaaatagtcgctgaccccatttttgtgatgatttgcatacgtggcacat 31326101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 3832388 - 3832434
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||| ||||||||||| || ||||||||    
3832388 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 3832434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 4042781 - 4042727
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||  |||||||||||||||||||| ||||||||||| || ||||||||    
4042781 gtccctgacttcacttttgtgatgatttgcacacgtgacacatgatgactgaacc 4042727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 20939216 - 20939162
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||||||||||| || ||||| ||||| || ||||||||    
20939216 gtccctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaacc 20939162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 23732220 - 23732166
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||||    
23732220 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 23732166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 29182277 - 29182319
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||| ||||||||||||||||||||| |||||||||||    
29182277 gtccctgactccacttttgtgatgatttgcacacgtgacacat 29182319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 34317915 - 34317961
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||| ||||||||||| || ||||||||    
34317915 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 34317961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 1138091 - 1138144
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||| ||||||||||||||||||||||||| ||||| ||||| || |||||||    
1138091 gtccccgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 1138144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 25750857 - 25750804
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||| |||||||||||||||||||||||||| ||||| ||||| || |||||||    
25750857 gtccttgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 25750804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 185 - 238
Target Start/End: Complemental strand, 44559299 - 44559246
Alignment:
185 tccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||| |||||||| |||||||||||| ||||||||||| || ||||||||    
44559299 tccctgactccacttttctgatgatttgcacacgtgacacatgatgactgaacc 44559246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 226
Target Start/End: Original strand, 13850635 - 13850671
Alignment:
190 gaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||||||||| |||||||||||    
13850635 gaccccacttttgtgatgatttgcacacgtgacacat 13850671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 44993957 - 44993909
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||| |||| |||| ||||||||||||||||||||||| |||||    
44993957 aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacat 44993909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 195 - 238
Target Start/End: Complemental strand, 5164376 - 5164333
Alignment:
195 cacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||| ||||||||||| || ||||||||    
5164376 cacttttgtgatgatttgcacacgtgacacatgatgactgaacc 5164333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 217
Target Start/End: Original strand, 36622349 - 36622388
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatac 217  Q
    |||||||||| |||||||| ||||||||||||||||||||    
36622349 aaaatagtccatgaccccatttttgtgatgatttgcatac 36622388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 4424004 - 4424058
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
4424004 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 4424058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 4842940 - 4842994
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| |||||||||||||||||| || ||||| ||||| || ||||||||    
4842940 gtccctgactccacttttgtgatgattttcacacgtggcacatgatgactgaacc 4842994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 16523098 - 16523152
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
16523098 gtccctggcgccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 16523152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 27109151 - 27109205
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
27109151 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 27109205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 34964044 - 34963998
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||| |||||||||| ||||||||||| || ||||||||    
34964044 ccccacttttgtaatgatttgcacacgtgacacatgatgactgaacc 34963998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 214
Target Start/End: Original strand, 37228831 - 37228861
Alignment:
184 gtccctgaccccacttttgtgatgatttgca 214  Q
    |||||||||||||||||||||||||||||||    
37228831 gtccctgaccccacttttgtgatgatttgca 37228861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 40125075 - 40125129
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
40125075 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 40125129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 226
Target Start/End: Original strand, 42695985 - 42696019
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacat 226  Q
    ||||||||||||||||||||||| |||||||||||    
42695985 ccccacttttgtgatgatttgcacacgtgacacat 42696019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 43672041 - 43672095
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||| ||||||||||||||| ||||||| ||||| ||||| || ||||||||    
43672041 gtccctggccccacttttgtgattatttgcacacgtggcacatgatgactgaacc 43672095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 11788166 - 11788214
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||| |||||||||||||||||| | ||||||||| ||||||||||    
11788166 ctgacccc-cttttgtgatgatttgcacatgtgacacatgataactgaac 11788214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 237
Target Start/End: Complemental strand, 1295437 - 1295385
Alignment:
185 tccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    |||||||| ||||||||||||||||||||| | ||| ||||| || |||||||    
1295437 tccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaac 1295385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 10374972 - 10374913
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgac-acattataactgaaccaa 240  Q
    ||||||||||||||||||     ||||||| ||||||||||||| | ||||||||||||||||||    
10374972 gaaaatagtccctgaccc-----ttgtgataatttgcatacgtggccacattataactgaaccaa 10374913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 236
Target Start/End: Complemental strand, 36815713 - 36815673
Alignment:
196 acttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    ||||||||||||||||||| ||||||||||| || ||||||    
36815713 acttttgtgatgatttgcacacgtgacacatgatgactgaa 36815673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0370 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0370
Description:

Target: scaffold0370; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 188 - 125
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
188 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 10257 - 10320
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
10257 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa 10320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0712 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0712
Description:

Target: scaffold0712; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 5311 - 5374
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
5311 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 5374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0709 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0709
Description:

Target: scaffold0709; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 5331 - 5394
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
5331 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 5394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0373
Description:

Target: scaffold0373; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 8649 - 8712
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
8649 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 8712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 14797 - 14860
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||    
14797 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 14860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35170 - 35107
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
35170 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 35107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 17942 - 17879
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||    
17942 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgtcactttataactgaaccaa 17879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 12284 - 12347
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||    
12284 gaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaa 12347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: scaffold0811
Description:

Target: scaffold0811; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1542 - 1479
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||||    
1542 gaaaatagtctctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaa 1479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: scaffold0535
Description:

Target: scaffold0535; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 8926 - 8864
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||    
8926 gaaaatagtccctgaccccacttt-gtgatgatttgcatacgtggcacattataactgaaccaa 8864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 5605 - 5542
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||    
5605 gaaaatagtccccgaccccacgtttgtgatgatttgcatacgtggcacattataactgaaccaa 5542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 4211 - 4149
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||    
4211 aaaatagaccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaa 4149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 3191 - 3132
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 236  Q
    |||||||||| |||||||||||||||||||||||||||||||||  ||||||||||||||    
3191 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggtacattataactgaa 3132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 8432 - 8493
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||||||||||||| ||||||||||||||||||| ||| ||||| || ||||||||    
8432 gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacc 8493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 94160 - 94220
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||||| |||||||| ||||||||||||||||||||||| ||||| || ||||||||    
94160 aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 94220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 366174 - 366114
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||| ||||||| ||||||||||||||| ||||||| ||||| || ||||||||    
366174 aaaatagtccccgaccccatttttgtgatgatttgtatacgtggcacatgatgactgaacc 366114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0326
Description:

Target: scaffold0326; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 4128 - 4175
Alignment:
186 ccctgaccccacttttgtgatgatttgcatacgtgacacattataact 233  Q
    |||||||||||||| || ||||||||||||||||| ||||||||||||    
4128 ccctgaccccacttctgggatgatttgcatacgtggcacattataact 4175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 19310 - 19357
Alignment:
186 ccctgaccccacttttgtgatgatttgcatacgtgacacattataact 233  Q
    |||||||||||||| || ||||||||||||||||| ||||||||||||    
19310 ccctgaccccacttctgggatgatttgcatacgtggcacattataact 19357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0166
Description:

Target: scaffold0166; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 24558 - 24495
Alignment:
177 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    |||||||||| |||||||  || ||||||||||||||||||||| | ||||||| |||||||||    
24558 gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaa 24495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 224
Target Start/End: Original strand, 47972 - 48014
Alignment:
182 tagtccctgaccccacttttgtgatgatttgcatacgtgacac 224  Q
    ||||||||||||||||||||||||||||||||| || ||||||    
47972 tagtccctgaccccacttttgtgatgatttgcacacttgacac 48014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold1001
Description:

Target: scaffold1001; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 2878 - 2925
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacaca 225  Q
    |||||||||| |||||||| ||||||||||||||| ||||||| ||||    
2878 aaaatagtccttgaccccatttttgtgatgatttgtatacgtggcaca 2925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0684
Description:

Target: scaffold0684; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 2412 - 2458
Alignment:
192 ccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||||||||||||||||| ||||| ||||| || ||||||||    
2412 ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 2458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 16832 - 16886
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    ||||||||| ||||||||||||||||||||| | ||| ||||| || ||||||||    
16832 gtccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaacc 16886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 34976 - 34922
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 238  Q
    |||||||  ||||||||| |||||||||||||| ||||||||| || ||||||||    
34976 gtccctggtcccacttttatgatgatttgcatatgtgacacatgatgactgaacc 34922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 220
Target Start/End: Complemental strand, 17863 - 17819
Alignment:
178 aaaatagtccctgaccccacttt--tgtgatgatttgcatacgtg 220  Q
    ||||||||||||||||||||| |  ||||||||||||||||||||    
17863 aaaatagtccctgaccccactatattgtgatgatttgcatacgtg 17819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 2615 - 2664
Alignment:
188 ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 237  Q
    ||||||||||||||||||| ||||||| ||||| ||||| || |||||||    
2615 ctgaccccacttttgtgattatttgcacacgtggcacatgatgactgaac 2664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 3818 - 3770
Alignment:
178 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat 226  Q
    |||||||||||||| | || |||||| |||||||||||||||| |||||    
3818 aaaatagtccctgatctcatttttgttatgatttgcatacgtggcacat 3770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 82450 - 82506
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 240  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||| ||||||    
82450 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaaccaa 82506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 189437 - 189473
Alignment:
184 gtccctgaccccacttttgtgatgatttgcatacgtg 220  Q
    ||||||| ||||||||||||||||||||||| |||||    
189437 gtccctggccccacttttgtgatgatttgcacacgtg 189473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University