View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2889_high_17 (Length: 239)
Name: NF2889_high_17
Description: NF2889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2889_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 41725394 - 41725615
Alignment:
| Q |
1 |
ttggttagtcaatataatccatgaaattactacaagaaaagtcactagagatgtgtttgtgattttgatacaataaggggctatactaacaacacctcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41725394 |
ttggttagtcaatataatccatgaaattagtacaagaaaagtcactagagatgtgtttgtgattttgatacaataaggggctatactaacaacacctcac |
41725493 |
T |
|
| Q |
101 |
atatttagagacctaaatggttgtttgctctaaacaaatgagtgggcatagtcaatttgattcttaaaattatgaccatttgtcaaactagtcactcgtt |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41725494 |
atatttagagacctcaatggttgtttgctctaaacaaatgagtgcgcatagtcaatttgattcttaaaattgtgaccatttgtcaaactagtcactcgtt |
41725593 |
T |
|
| Q |
201 |
ttggcgaattgacttaaacatc |
222 |
Q |
| |
|
||||| ||||||| |||||||| |
|
|
| T |
41725594 |
ttggcaaattgacataaacatc |
41725615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 118
Target Start/End: Complemental strand, 25021091 - 25021022
Alignment:
| Q |
49 |
agatgtgtttgtgattttgatacaataaggggctatactaacaacacctcacatatttagagacctaaat |
118 |
Q |
| |
|
||||||| ||| ||||||||||| | |||| ||||| | |||||||||||||||||||| |||| |||| |
|
|
| T |
25021091 |
agatgtgcttgcaattttgatacattcagggactataatgacaacacctcacatatttagggaccaaaat |
25021022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University