View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2889_low_13 (Length: 320)
Name: NF2889_low_13
Description: NF2889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2889_low_13 |
 |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0210 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0811 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (2 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 3e-79; HSPs: 72)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 8 - 240
Target Start/End: Complemental strand, 38963161 - 38962929
Alignment:
| Q |
8 |
tagcataggtgctgtagaaataatagtggcagttacatatagggaaatataattatttagaggatatattatttgctttatatgatatgaaacataaaag |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38963161 |
tagcataggtgatgtagaaataatagtggcagttacatatagggaaatataattatttagaggatatattatttgctttatatgatatgaaacataaaag |
38963062 |
T |
 |
| Q |
108 |
gctaaaatatggttttagtctctgt--nnnnnnngaaattgtttttggtccttgcaaaannnnnnnnnnnngaaaatagtccctgaccccacttttgtga |
205 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38963061 |
gctaaaatatggttttagtctctgtaaaaaaaaaaaaattgtttttggtctttgcaaaa--ttttgtttttgaaaatagtccctgaccccacttttgtga |
38962964 |
T |
 |
| Q |
206 |
tgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38962963 |
tgatttgcatacgtgacacattataactgaaccaa |
38962929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 294091 - 294028
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
294091 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
294028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 29151618 - 29151681
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29151618 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
29151681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 42207342 - 42207405
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42207342 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
42207405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 177 - 237
Target Start/End: Complemental strand, 25779060 - 25779000
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25779060 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
25779000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 2217756 - 2217693
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2217756 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
2217693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 6118393 - 6118330
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6118393 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
6118330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 15635477 - 15635540
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15635477 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
15635540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 18633859 - 18633796
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18633859 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
18633796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 23382208 - 23382145
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23382208 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa |
23382145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 31037497 - 31037560
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31037497 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
31037560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35166058 - 35165995
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35166058 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
35165995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 38496521 - 38496584
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38496521 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
38496584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 177 - 237
Target Start/End: Complemental strand, 37090640 - 37090580
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37090640 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
37090580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 4203554 - 4203617
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
4203554 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacatattataattgaaccaa |
4203617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 5614428 - 5614365
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5614428 |
gaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
5614365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 16038638 - 16038575
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16038638 |
gaaaatagtctctgaccccacttttgtgattatttgcatacgtgacacattataactgaaccaa |
16038575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 16616463 - 16616526
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16616463 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
16616526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 27850275 - 27850212
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
27850275 |
gaaaatagtccctgaccccacttttgtgatggtttgcatacgtggcacattataactgaaccaa |
27850212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 29172625 - 29172688
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
29172625 |
gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa |
29172688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 29692991 - 29692928
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29692991 |
gaaaatagtccctgaccccacttttatgatgatttgcatacgtggcacattataactgaaccaa |
29692928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35167064 - 35167001
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35167064 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
35167001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 36577821 - 36577884
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36577821 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
36577884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 179 - 240
Target Start/End: Complemental strand, 21125170 - 21125109
Alignment:
| Q |
179 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
21125170 |
aaatagtccctgaccccacttttgtgataatttgcatacgtgacacattataattgaaccaa |
21125109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 10409033 - 10409095
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10409033 |
gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactaaaccaa |
10409095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 18046250 - 18046187
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
18046250 |
gaaaatagtctctgaccccacttttgtgataatttgcatacgtgtcacattataactgaaccaa |
18046187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 21050675 - 21050738
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21050675 |
gaaaatagtccttgacctcacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
21050738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 28550927 - 28550990
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
28550927 |
gaaaatagtccctaaccccacttttgtgatgatttgcatacatggcacattataactgaaccaa |
28550990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 29875501 - 29875564
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29875501 |
gaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaa |
29875564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 30888262 - 30888325
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
30888262 |
gaaaatagtccctgaccccacttttgtgatgatttgcatatatggcacattataactgaaccaa |
30888325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 33335923 - 33335864
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33335923 |
gaaaatagtccttgaccccacttttgtgattatttgcatacgtgacacattataactgaa |
33335864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 39379330 - 39379393
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39379330 |
gaaaatagtcccggatcccacttttatgatgatttgcatacgtgacacattataactgaaccaa |
39379393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 38786259 - 38786321
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38786259 |
gaaaatagtctctgacctcatttttgtgatgatttgcatacgtgacacattataactgaacca |
38786321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 5950274 - 5950337
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
5950274 |
gaaaatagtctttgaccccacttttgtgatgatttgcatacgtggcacattataactgatccaa |
5950337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 7075860 - 7075797
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7075860 |
gaaaatagtccctggctccacttttgtgatgatttgcatatgtggcacattataactgaaccaa |
7075797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 14318300 - 14318239
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
14318300 |
gaaaatagtccctgaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacc |
14318239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 28863732 - 28863672
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
28863732 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgtcacatgatgactgaacc |
28863672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 30800750 - 30800687
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
30800750 |
gaaaatagtccctgacctgacttttgtgattatttgcatacgtggtacattataactgaaccaa |
30800687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 40029240 - 40029303
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40029240 |
gaaaatagtccctaactccacttttgtgatgattgatatacgtgacacattataactgaaccaa |
40029303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 27916564 - 27916626
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||| || || |||||||||| |
|
|
| T |
27916564 |
aaaatagtccctgaccccatttttgtgataatttgcatacgtgacagatgatgactgaaccaa |
27916626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 3850525 - 3850465
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
3850525 |
aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
3850465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 10743953 - 10743893
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||| ||||| || |||||||| |
|
|
| T |
10743953 |
aaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcacatgatgactgaacc |
10743893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 5904260 - 5904210
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
5904260 |
ctgacctcacttttgtgatgatttgcatacgtgacatatgataactgaacc |
5904210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 10830638 - 10830692
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| || |||||||| |
|
|
| T |
10830638 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacaagatgactgaacc |
10830692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 20661057 - 20661099
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20661057 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacat |
20661099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 29366847 - 29366799
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
29366847 |
aaaataatccctgaccccatttttgtgatgatttacatacgtgacacat |
29366799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 237
Target Start/End: Complemental strand, 22551214 - 22551155
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||| || ||||||| |
|
|
| T |
22551214 |
aaaatagtccctgaccccacttttgtgatgagctgcatacgtggtacatgatgactgaac |
22551155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 24782175 - 24782112
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||| || ||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
24782175 |
gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaa |
24782112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 1286938 - 1286884
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||| || |||||||| |
|
|
| T |
1286938 |
gtccctgtccccacttttgtgatgatttgcaagcgtgacacataatgactgaacc |
1286884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 20690840 - 20690882
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
20690840 |
gtccctgaccccacttttgtgatgatttgcatacatggcacat |
20690882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 28213490 - 28213536
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
28213490 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
28213536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 35609382 - 35609436
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
35609382 |
gtccctgtcgccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
35609436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 181 - 238
Target Start/End: Complemental strand, 3850719 - 3850662
Alignment:
| Q |
181 |
atagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||| ||||||||| || |||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
3850719 |
atagtctctgaccccatttatgtgatgatttgcatacgtggcacatgatgactgaacc |
3850662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 9532291 - 9532340
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| | || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9532291 |
gaaaatagttcttggccccatttttgtgatgatttgcatacgtgacacat |
9532340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 13990708 - 13990756
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||| |||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
13990708 |
aaaatagtccatgaccctatttttgtgatgatttgcatacgtggcacat |
13990756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 226
Target Start/End: Original strand, 17070646 - 17070686
Alignment:
| Q |
186 |
ccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
17070646 |
ccctgaccccacttttgtgatgatttgcacacgtggcacat |
17070686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 238
Target Start/End: Original strand, 26071397 - 26071453
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||| || |||||||| |
|
|
| T |
26071397 |
tagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatgactgaacc |
26071453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 239
Target Start/End: Complemental strand, 37271597 - 37271542
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||| ||||| || ||||||||| |
|
|
| T |
37271597 |
gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaacca |
37271542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 4736433 - 4736379
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| |||||||||||||||| |||| ||||| ||||| || |||||||| |
|
|
| T |
4736433 |
gtccctgactccacttttgtgatgatctgcacacgtggcacatgatgactgaacc |
4736379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 5103897 - 5103847
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||| || |||||||| |
|
|
| T |
5103897 |
ctgatcccacttttgtgatgatttgcacatgtgacacatgatgactgaacc |
5103847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 15916395 - 15916437
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
15916395 |
gtccctgacctcacttttgtgatgatttgcacatgtgacacat |
15916437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 25561814 - 25561868
Alignment:
| Q |
183 |
agtccctgaccccac-ttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
25561814 |
agtctctgaccccaccttttgtgatgatttgcatatgtagcacattataactgaa |
25561868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 31602264 - 31602310
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| |||| |||||| |
|
|
| T |
31602264 |
ccccacttttgtgatgatttgcacacgtggcacatgataattgaacc |
31602310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 236
Target Start/End: Original strand, 36973472 - 36973514
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
36973472 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaa |
36973514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 40038604 - 40038658
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
40038604 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
40038658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 42553757 - 42553806
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |||||||||| |
|
|
| T |
42553757 |
ctgaccccactttacagatgatttgcacacgtgacacatgataactgaac |
42553806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 193 - 238
Target Start/End: Original strand, 42596571 - 42596616
Alignment:
| Q |
193 |
cccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||| | || |||||||| ||||||||||| |
|
|
| T |
42596571 |
cccacttttgtgatgatttggacacatgacacatgataactgaacc |
42596616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 9179820 - 9179760
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| | ||||||| | |||||||||||||| |||||| ||||| ||||| ||||| |
|
|
| T |
9179820 |
aaaatagtctccgaccccattattgtgatgatttgcctacgtggcacatgataaccgaacc |
9179760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 11935861 - 11935805
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| ||||| |||| |||||| |||||| |
|
|
| T |
11935861 |
gtccctgaccccccttttatgatgatttgcacacgtggtacatgataactcaaccaa |
11935805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 214
Target Start/End: Complemental strand, 26133311 - 26133275
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgca |
214 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
26133311 |
aaaatagtccctaaccccatttttgtgatgatttgca |
26133275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 32108926 - 32108970
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
32108926 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
32108970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 34125408 - 34125467
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||| | |||| |||||||||||||||||| ||||| || |||||||| |
|
|
| T |
34125408 |
aaaatagtctctgaccc-atttttttgatgatttgcatacgtggcacatgatgactgaacc |
34125467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 6e-28; HSPs: 73)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 22917826 - 22917763
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22917826 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
22917763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 1163013 - 1163076
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1163013 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
1163076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 4375791 - 4375854
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4375791 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
4375854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 6146847 - 6146784
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6146847 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
6146784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 8094581 - 8094644
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8094581 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaa |
8094644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 19494220 - 19494283
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19494220 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
19494283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 25131210 - 25131273
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25131210 |
gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa |
25131273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 28398938 - 28398875
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28398938 |
gaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
28398875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 38930403 - 38930466
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38930403 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
38930466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 40493054 - 40493117
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40493054 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
40493117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 4017005 - 4017067
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4017005 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
4017067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 21125919 - 21125857
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21125919 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
21125857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 21509796 - 21509858
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21509796 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
21509858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 1525911 - 1525974
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
1525911 |
gaaaatagtccctgaccccacttttgtgatgatttgcataagtggcacattataactgaaccaa |
1525974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 6146616 - 6146679
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6146616 |
gaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
6146679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 181 - 240
Target Start/End: Complemental strand, 16789268 - 16789209
Alignment:
| Q |
181 |
atagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16789268 |
atagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa |
16789209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 33636424 - 33636487
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
33636424 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacagaaccaa |
33636487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 40066595 - 40066658
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40066595 |
gaaaatagtctctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa |
40066658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1408253 - 1408190
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
1408253 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcatattataactgaaccaa |
1408190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 14495299 - 14495236
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| |
|
|
| T |
14495299 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacctaataactgaaccaa |
14495236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 16643942 - 16643879
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16643942 |
gaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaa |
16643879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 24187668 - 24187731
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
24187668 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacttggcacattataactgaaccaa |
24187731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 232
Target Start/End: Complemental strand, 24954910 - 24954855
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24954910 |
gaaaatagtccctgaccccacttttgtgatgatttgcataagtgacacattataac |
24954855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 103 - 240
Target Start/End: Complemental strand, 32040344 - 32040209
Alignment:
| Q |
103 |
aaaaggctaaaatatggttttagtctctgtnnnnnnngaaattgtttttggtccttgcaaaannnnnnnnnnnngaaaatagtccctgaccccacttttg |
202 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
32040344 |
aaaaggctaaaatatggttttagtccctgtaaaaaa--aaattgtttttggtccctgcaaaattttttgtttttgaaaatagtctctgaccccacttttg |
32040247 |
T |
 |
| Q |
203 |
tgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
32040246 |
tgatgatttgcatacgtggcacgttataattgaaccaa |
32040209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 7272522 - 7272585
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7272522 |
gaaaatagtccctagccccacttttgtgatgatttgcatacgtgttacattataactgaaccaa |
7272585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 10776397 - 10776334
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||| |||||||| |||||||||| |
|
|
| T |
10776397 |
gaaaatagtccttgaccccacttttgtgatgattttcatacgtggcacattatgactgaaccaa |
10776334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 232
Target Start/End: Original strand, 22650568 - 22650623
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataac |
232 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22650568 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataac |
22650623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 177 - 235
Target Start/End: Original strand, 1685216 - 1685274
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactga |
235 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1685216 |
gaaaataggccctaaccccacttttgtgatgatttgcatacgtggcacattataactga |
1685274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 35115590 - 35115536
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
35115590 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaacc |
35115536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 15719758 - 15719818
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
15719758 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
15719818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 33526155 - 33526215
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
33526155 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
33526215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 14488816 - 14488877
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||| ||||| || |||||||| |
|
|
| T |
14488816 |
gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacc |
14488877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 14238852 - 14238912
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||| | || |||||||| |
|
|
| T |
14238852 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacctgatgactgaacc |
14238912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 19946277 - 19946352
Alignment:
| Q |
29 |
aatagtggcagttacata--tagggaaatataattatttagaggatatattatttgctttatatgatatgaaacat |
102 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| |||||||| ||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
19946277 |
aatagtggcagttacataaatagggagatatagttatttaggggatatactattttcttcatatgatatgaaacat |
19946352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 19963099 - 19963159
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| | || ||||||||||| |
|
|
| T |
19963099 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgataactgaacc |
19963159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 43477411 - 43477351
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| | ||||| || |||||||| |
|
|
| T |
43477411 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgagtcacatgatgactgaacc |
43477351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 23939654 - 23939709
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||| || ||||||| |
|
|
| T |
23939654 |
tagtccctgaccccacttttgtgatgatttgcacatgtgacacatgatgactgaac |
23939709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 27341489 - 27341426
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||| | || ||||| |||||| ||||||||||||||||||| |
|
|
| T |
27341489 |
gaaaatagtctctgaccccacttttgcggtggtttgcttacgtggcacattataactgaaccaa |
27341426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 29158456 - 29158519
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| || |||||||||||||||| |||| |||||||||||| |||||||||||||| |
|
|
| T |
29158456 |
gaaaatagtctcttaccccacttttgtgataatttatatacgtgacacaatataactgaaccaa |
29158519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 30337023 - 30337066
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtg |
220 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30337023 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtg |
30337066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 28497363 - 28497417
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
28497363 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
28497417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 29992192 - 29992138
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||| || |||||||| |
|
|
| T |
29992192 |
gtccctgaccccacttttgtgatgatttacacacgtgacacatgatgactgaacc |
29992138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 18549305 - 18549354
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
18549305 |
gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacat |
18549354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 32195381 - 32195430
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
32195381 |
gaaaatagtctctgaccccacttttatgatgatatgcatacgtgacacat |
32195430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 10755429 - 10755369
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
10755429 |
aaaatagtccccgactccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
10755369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 29488009 - 29487949
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| ||| ||||| || |||||||| |
|
|
| T |
29488009 |
aaaatagtccttgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacc |
29487949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 32418577 - 32418529
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
32418577 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacat |
32418529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 40844434 - 40844386
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
40844434 |
aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacat |
40844386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 43727328 - 43727268
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| ||||||| ||||| || |||||||| |
|
|
| T |
43727328 |
aaaatagtccttgaccccatttttgtgatgatttggatacgtggcacatgatgactgaacc |
43727268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 182 - 237
Target Start/End: Complemental strand, 17074061 - 17074006
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||| || ||||||| |
|
|
| T |
17074061 |
tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac |
17074006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 182 - 237
Target Start/End: Original strand, 17574209 - 17574264
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||| || ||||||| |
|
|
| T |
17574209 |
tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac |
17574264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 8298696 - 8298750
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
8298696 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
8298750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 13232307 - 13232361
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
13232307 |
gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
13232361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 14496914 - 14496975
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||| |||||||||| || ||||||||||||||||||| ||| ||||| || |||||||| |
|
|
| T |
14496914 |
gaaaatcgtccctgacctcatttttgtgatgatttgcatatgtggcacatgatgactgaacc |
14496975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 189 - 238
Target Start/End: Complemental strand, 15931155 - 15931106
Alignment:
| Q |
189 |
tgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
15931155 |
tgaccccacttttgtgatgatttgcacacgtgtcacatgatgactgaacc |
15931106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 20277801 - 20277854
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||| ||||||||||||||||||||| | ||||| ||||| |||||||||| |
|
|
| T |
20277801 |
gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac |
20277854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 21064428 - 21064481
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||| ||||||||||||||||||||| | ||||| ||||| |||||||||| |
|
|
| T |
21064428 |
gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac |
21064481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 7578429 - 7578369
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| |||||| | ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
7578429 |
aaaatagtctttgacccaatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
7578369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 35143743 - 35143684
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| ||| ||||| ||||| ||||| |
|
|
| T |
35143743 |
aaaatagtccatgacccca-ttttgtgatgatttgcataagtggcacatgataaccgaacc |
35143684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 2355997 - 2356048
Alignment:
| Q |
187 |
cctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| |||||||||||||||||||| || |||||||| || |||||||| |
|
|
| T |
2355997 |
cctgacctcacttttgtgatgatttgcacacatgacacatgatgactgaacc |
2356048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 222
Target Start/End: Complemental strand, 5357654 - 5357616
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgac |
222 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
5357654 |
gtccctgactccacttttgtgatgatttgcacacgtgac |
5357616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 6469557 - 6469503
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||| |||| | ||||| |||||||| |||||||| |
|
|
| T |
6469557 |
gtccctgaccccacttttgtgattatttaaacacgtggcacattatgactgaacc |
6469503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 7326195 - 7326249
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
7326195 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
7326249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 7420339 - 7420393
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
7420339 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
7420393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 42430011 - 42429957
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
42430011 |
gtccctggccccatttttgtgatgatttgcacacgtggcacatgatgactgaacc |
42429957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 226
Target Start/End: Original strand, 2811555 - 2811592
Alignment:
| Q |
189 |
tgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
2811555 |
tgaccccacttttgtgatgatttgtatacgtggcacat |
2811592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 25600340 - 25600393
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||| | ||||||||||||||||||||| || |||||||| || ||||||| |
|
|
| T |
25600340 |
gtccctgtctccacttttgtgatgatttgcacacatgacacatgatgactgaac |
25600393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 36044682 - 36044629
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||| |||| || ||||||| |
|
|
| T |
36044682 |
gtccctgacctcacttttgtgatgatttgcacatgtgatacatgatgactgaac |
36044629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 1778673 - 1778725
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||| |
|
|
| T |
1778673 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
1778725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Complemental strand, 4621235 - 4621191
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| || |||||||| |
|
|
| T |
4621235 |
ccacttttgtgatgatttgcacacgtcacacatgatgactgaacc |
4621191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 190 - 238
Target Start/End: Complemental strand, 9175257 - 9175209
Alignment:
| Q |
190 |
gaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||||| || || ||||| || |||||||| |
|
|
| T |
9175257 |
gaccccacttttgtgatgatttgcacacatggcacatgatgactgaacc |
9175209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 13154995 - 13155047
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| ||||| || |||||| |
|
|
| T |
13154995 |
gtccctgaccccacttttgtattgatttgcacacgtggcacatgatgactgaa |
13155047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 24814814 - 24814866
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||| ||||| || |||||| |
|
|
| T |
24814814 |
gtccctgaccccacttttgttatgatttgcacacgtagcacatgatgactgaa |
24814866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 6e-28; HSPs: 70)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1559605 - 1559542
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1559605 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
1559542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 30709425 - 30709488
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30709425 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
30709488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 28911679 - 28911740
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28911679 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
28911740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 488814 - 488877
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488814 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
488877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1007128 - 1007065
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1007128 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
1007065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 5308586 - 5308523
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5308586 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
5308523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 6108596 - 6108533
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6108596 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
6108533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 7432053 - 7432116
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7432053 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
7432116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 22871162 - 22871225
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22871162 |
gaaaatagaccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
22871225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 37372804 - 37372741
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37372804 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgatacattataactgaaccaa |
37372741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 39719455 - 39719518
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39719455 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
39719518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 45021597 - 45021660
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45021597 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
45021660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 12894301 - 12894238
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12894301 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
12894238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 19783916 - 19783979
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19783916 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
19783979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 21223508 - 21223571
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21223508 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
21223571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 25547390 - 25547327
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25547390 |
gaaaatagtctctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaa |
25547327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 31732350 - 31732287
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31732350 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaa |
31732287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35015118 - 35015055
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35015118 |
gaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
35015055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 39833005 - 39833068
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39833005 |
gaaaatagttcctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa |
39833068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 45073541 - 45073478
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45073541 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
45073478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 46304281 - 46304218
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46304281 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
46304218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 48358975 - 48358913
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48358975 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
48358913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 14738700 - 14738763
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14738700 |
gaaaatagtctctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
14738763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 17999623 - 17999560
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
17999623 |
gaaaatagtccctgaccccacgtttgtgataatttgcatacgtggcacattataactgaaccaa |
17999560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 19561249 - 19561312
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
19561249 |
gaaaatagtccctgacaccacttttgtgatgatttgcatatgtggcacattataactgaaccaa |
19561312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 21554652 - 21554589
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
21554652 |
gaaaatagtccctgaccccacttttgtgatgttttgcatatgtggcacattataactgaaccaa |
21554589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 30352662 - 30352725
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30352662 |
gaaaatagtccctgactccatttttgtgatgatttgcatacgtggcacattataactgaaccaa |
30352725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 44344690 - 44344627
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
44344690 |
gaaaatagtcactgaccccacttttgtgatgattttcatacgtggcacattataactgaaccaa |
44344627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 44403151 - 44403088
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
44403151 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataactgaaccaa |
44403088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 18022468 - 18022530
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
18022468 |
aaaataatccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa |
18022530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 18311682 - 18311744
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
18311682 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaa |
18311744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 44508820 - 44508883
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||| |||||||||| |||||||| |
|
|
| T |
44508820 |
gaaaatagtctctgaccccacttttgttatgatttgcatacgtggcacattataagtgaaccaa |
44508883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 10358105 - 10358167
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||||| |
|
|
| T |
10358105 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaa |
10358167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 178 - 236
Target Start/End: Complemental strand, 31310577 - 31310519
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
31310577 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattatgactgaa |
31310519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 35665984 - 35666037
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
35665984 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaac |
35666037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 35210411 - 35210352
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||| | ||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
35210411 |
gaaaatagtccttaaccccacttttgtgatgatgtgcatacgtggcacattataactgaa |
35210352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 19757851 - 19757912
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
19757851 |
gaaaatagtcactgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
19757912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 178 - 237
Target Start/End: Original strand, 45671314 - 45671373
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||| ||||||||| || ||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
45671314 |
aaaataatccctgacctcatttttgtgatgatttgcatacgtgacacatgatgactgaac |
45671373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 46759864 - 46759810
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
46759864 |
gtccctgactccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
46759810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 195 - 240
Target Start/End: Complemental strand, 1974207 - 1974162
Alignment:
| Q |
195 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1974207 |
cactattgtgatgatttgcatacgtgacaaattataactgaaccaa |
1974162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 20388376 - 20388436
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||| || || || |||||||| |
|
|
| T |
20388376 |
aaaatagttcctgaccccatttttgtgatgatttgcatacgtggcatatgatgactgaacc |
20388436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 9659464 - 9659518
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
9659464 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
9659518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 27458508 - 27458562
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
27458508 |
gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
27458562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 220
Target Start/End: Complemental strand, 17854356 - 17854315
Alignment:
| Q |
179 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtg |
220 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
17854356 |
aaatagtccctgactccatttttgtgatgatttgcatacgtg |
17854315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 178 - 219
Target Start/End: Complemental strand, 37952950 - 37952909
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgt |
219 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
37952950 |
aaaatagtccatgaccccacttttgtgattatttgcatacgt |
37952909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 226
Target Start/End: Complemental strand, 3808072 - 3808028
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
3808072 |
tagtctctgacctcacttttgtgatgatttgcacacgtgacacat |
3808028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 6589080 - 6589124
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
6589080 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
6589124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 13769874 - 13769933
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||| |||||| | ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
13769874 |
aaaatagtcc-tgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
13769933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 23816933 - 23816885
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| ||||||| ||||| |
|
|
| T |
23816933 |
aaaatagtctctgaccccatttttgtgatgatttgtatacgtggcacat |
23816885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 193 - 237
Target Start/End: Complemental strand, 28262960 - 28262916
Alignment:
| Q |
193 |
cccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
28262960 |
cccacttttgtgatgatttgcacacgtgacacataatgactgaac |
28262916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 226
Target Start/End: Original strand, 35104125 - 35104169
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
35104125 |
tagtccctgactccacttttgtgatgatttgcacacgtggcacat |
35104169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 46648516 - 46648575
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| |||||| ||||| || |||||||| |
|
|
| T |
46648516 |
aaaatagtcc-tgaccccatttttgtgatgatttgcgtacgtggcacatgatgactgaacc |
46648575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 46829201 - 46829145
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||||||| || | |||||||| |
|
|
| T |
46829201 |
gtccctgactccacttttgtgatgatttgcacacatgacacatgatgattgaaccaa |
46829145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 191 - 238
Target Start/End: Original strand, 19465733 - 19465780
Alignment:
| Q |
191 |
accccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
19465733 |
accccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
19465780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 195 - 238
Target Start/End: Complemental strand, 38186642 - 38186599
Alignment:
| Q |
195 |
cacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
38186642 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
38186599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 2945736 - 2945694
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
2945736 |
gtccctggccccacttttgtgatgatttgcacacgtggcacat |
2945694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 5355009 - 5354955
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
5355009 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
5354955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 214
Target Start/End: Original strand, 6892003 - 6892033
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6892003 |
gtccctgaccccacttttgtgatgatttgca |
6892033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 236
Target Start/End: Complemental strand, 28529150 - 28529108
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
28529150 |
ccacttttgtgatgatttgcacacgtgacacataatgactgaa |
28529108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 35838033 - 35838075
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
35838033 |
gtccctgactccacttttgtgatgatttgcacacgtggcacat |
35838075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 226
Target Start/End: Complemental strand, 37527305 - 37527271
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37527305 |
ccccacttttgtgatgatttgcacacgtgacacat |
37527271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 39438920 - 39438878
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
39438920 |
gtccctgactccacttttgtgatgatttgcacatgtgacacat |
39438878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 39520507 - 39520561
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
39520507 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
39520561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 48852553 - 48852607
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| | ||||||||| || |||||||| |
|
|
| T |
48852553 |
gtccctggctccacttttgtgatgatttgcacatgtgacacatgatgactgaacc |
48852607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 16940871 - 16940924
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
16940871 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
16940924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 11767036 - 11767080
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
11767036 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
11767080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 236
Target Start/End: Original strand, 14543799 - 14543839
Alignment:
| Q |
196 |
acttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
14543799 |
acttttgtgatgatttgcacacgtgacacatgatgactgaa |
14543839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 132
Target Start/End: Complemental strand, 23817037 - 23817009
Alignment:
| Q |
104 |
aaaggctaaaatatggttttagtctctgt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23817037 |
aaaggctaaaatatggttttagtctctgt |
23817009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 24954049 - 24953989
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||| ||| ||||| || |||||||| |
|
|
| T |
24954049 |
aaaatagtctttgacctcacttttatgatgatttgcatatgtggcacataatgactgaacc |
24953989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 30223580 - 30223624
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
30223580 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
30223624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 6e-28; HSPs: 52)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 31398440 - 31398377
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31398440 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
31398377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 2616134 - 2616071
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2616134 |
gaaaatagtccctgaccacacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
2616071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 14655669 - 14655606
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14655669 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
14655606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 15076103 - 15076040
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15076103 |
gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa |
15076040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 15116773 - 15116836
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116773 |
gaaaatagtccctgtccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
15116836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 17321453 - 17321390
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17321453 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
17321390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 17321586 - 17321523
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17321586 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
17321523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 24273939 - 24274002
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24273939 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
24274002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 30928944 - 30928881
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30928944 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaa |
30928881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 33801642 - 33801579
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33801642 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
33801579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 8680877 - 8680940
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
8680877 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaa |
8680940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 10091135 - 10091198
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10091135 |
gaaaatagtccatgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa |
10091198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 31166971 - 31167034
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
31166971 |
gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa |
31167034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 34582631 - 34582694
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34582631 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
34582694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 317911 - 317973
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
317911 |
aaaatagtctctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
317973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 26375794 - 26375856
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26375794 |
aaaatagtccctaacctcacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
26375856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 179 - 240
Target Start/End: Original strand, 15962131 - 15962192
Alignment:
| Q |
179 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15962131 |
aaatagtccctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
15962192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Complemental strand, 543622 - 543562
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
543622 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
543562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 777939 - 777875
Alignment:
| Q |
177 |
gaaaatagtccc-tgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
777939 |
gaaaatagtcccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
777875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Complemental strand, 24692880 - 24692820
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24692880 |
gaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaac |
24692820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 494661 - 494602
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
494661 |
gaaaatagtccctgaccccacttttgtgatgatctgcatacgtggcacattataactgaa |
494602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 1890161 - 1890224
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
1890161 |
gaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaa |
1890224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 3356400 - 3356337
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
3356400 |
gaaaatagtctctgaccccacttttgtgtttatttgcatacgtgacacattataactgaaccaa |
3356337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 7155898 - 7155961
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7155898 |
gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
7155961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 11129302 - 11129365
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||| |
|
|
| T |
11129302 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcagatgataactgaaccaa |
11129365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 19296305 - 19296242
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
19296305 |
gaaaatagtccctgaccccacttttgtgatgatttacatatgtggcacattataactgaaccaa |
19296242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 6468570 - 6468508
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
6468570 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccaa |
6468508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 6591339 - 6591277
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6591339 |
aaaatagtgcctgactccacttttgtgatgatttgcatacgtgacacattataactaaaccaa |
6591277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 7324091 - 7324029
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
7324091 |
aaaatagtccctgaccccacttttatgatgatttgcatacggggcacattataactgaaccaa |
7324029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 32885774 - 32885837
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32885774 |
gaaaatagtctctgcccctacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
32885837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 19275939 - 19275879
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
19275939 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
19275879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 21995167 - 21995227
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
21995167 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
21995227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 24901347 - 24901401
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24901347 |
gtccctgactccacttttgtgatgatttgcacacgtgacacatgataactgaacc |
24901401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 2373391 - 2373331
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||| ||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
2373391 |
aaaatagccgctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc |
2373331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 14428751 - 14428811
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
14428751 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
14428811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 33131626 - 33131686
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
33131626 |
aaaatagtccctaaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacc |
33131686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 5286687 - 5286753
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgt---gacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| || | |||||||||| |||||||| |
|
|
| T |
5286687 |
gaaaatagtccctggccccacttttgtgatgatttgcatatgtggcggcacattataaatgaaccaa |
5286753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 177 - 225
Target Start/End: Original strand, 17772014 - 17772062
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacaca |
225 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
17772014 |
gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcaca |
17772062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 184 - 235
Target Start/End: Complemental strand, 25121388 - 25121337
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactga |
235 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
25121388 |
gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactga |
25121337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 15722719 - 15722773
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||| |||||||||||| |||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
15722719 |
gtccccgaccccacttttatgatcatttgcacacgtgacacatgataactgaacc |
15722773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 238
Target Start/End: Original strand, 1214801 - 1214857
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| | | ||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
1214801 |
tagtccctggctctacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
1214857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 12612256 - 12612196
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||| | ||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
12612256 |
aaaatagtctctggctccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
12612196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 13268218 - 13268254
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13268218 |
gtccctgaccccacttttgtgatgatttgcacacgtg |
13268254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 13617648 - 13617692
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
13617648 |
ccacttttgtgatgatttgcacacgtggcacatgataactgaacc |
13617692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 236
Target Start/End: Original strand, 11448650 - 11448701
Alignment:
| Q |
189 |
tgaccccacttttgtgatgatttgca----tacgtgacacattataactgaa |
236 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11448650 |
tgaccctacttttgtgatgatttgcatacgtacgtgacacattataactgaa |
11448701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 12298927 - 12298969
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
12298927 |
gtccctggccccacttttgtgatgatttgcacacgtggcacat |
12298969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 14656012 - 14656066
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| |||||||||||||| |||||||| | ||||||||| || |||||||| |
|
|
| T |
14656012 |
gtccctggccccacttttgtgacgatttgcacatgtgacacatgatcactgaacc |
14656066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 19320876 - 19320930
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
19320876 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
19320930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 30479168 - 30479222
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| ||||||||||||||| |||||| ||||||||||| || |||||||| |
|
|
| T |
30479168 |
gtccctggccccacttttgtgataatttgcgcacgtgacacatgatgactgaacc |
30479222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 31198724 - 31198778
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
31198724 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
31198778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 8170043 - 8169991
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||| ||||||||| ||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
8170043 |
gtccctggccccacttt-gtgatgatttgcacacgtgacacatgatgactgaac |
8169991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 226
Target Start/End: Complemental strand, 3276235 - 3276203
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
3276235 |
ccacttttgtgatgatttgcacacgtgacacat |
3276203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 6e-28; HSPs: 79)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 13479371 - 13479434
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479371 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
13479434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 24474861 - 24474798
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24474861 |
gaaaatagtccctgaccccacttttctgatgatttgcatacgtgacacattataactgaaccaa |
24474798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 41920983 - 41920920
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41920983 |
gaaaatagtccctgaccctacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
41920920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 50714464 - 50714401
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50714464 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
50714401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 51708926 - 51708863
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51708926 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
51708863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 53717071 - 53717009
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53717071 |
aaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
53717009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 4279233 - 4279170
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4279233 |
gaaaatagtacctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
4279170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 6827772 - 6827709
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6827772 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
6827709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 18136014 - 18135951
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18136014 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa |
18135951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 27008306 - 27008243
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27008306 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa |
27008243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 29463812 - 29463749
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29463812 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataattgaaccaa |
29463749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 34355065 - 34355128
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34355065 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
34355128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 34362044 - 34361981
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34362044 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
34361981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 35415401 - 35415464
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35415401 |
gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
35415464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 36702101 - 36702164
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
36702101 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattatgactgaaccaa |
36702164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 38054646 - 38054705
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38054646 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaa |
38054705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 41346117 - 41346054
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41346117 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaa |
41346054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 41620154 - 41620091
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41620154 |
gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
41620091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 49123222 - 49123159
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49123222 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa |
49123159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 55482369 - 55482306
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
55482369 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaa |
55482306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 3178784 - 3178847
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3178784 |
gaaaatagtccctgaccccacttttttaatgatttgcatacatgacacattataactgaaccaa |
3178847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 232
Target Start/End: Complemental strand, 9446223 - 9446168
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataac |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9446223 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgaaacattataac |
9446168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 18830946 - 18831009
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18830946 |
gaaaatagtcactggcctcacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
18831009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 22584509 - 22584446
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22584509 |
gaaaatagtccatgaccccacttctgtgatgatttgcatacatgacacattataactgaaccaa |
22584446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 27427944 - 27428007
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||| |
|
|
| T |
27427944 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacaatataactaaaccaa |
27428007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 32208642 - 32208705
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
32208642 |
gaaaatagtccctgaccctacttttgtgattatttgtatacgtgacacattataactgaaccaa |
32208705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 52017768 - 52017705
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52017768 |
gaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaa |
52017705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 55072492 - 55072554
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55072492 |
aaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaa |
55072554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 13064260 - 13064313
Alignment:
| Q |
179 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13064260 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataac |
13064313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 123793 - 123730
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
123793 |
gaaaatagtccctaaccctacttttgtggtgatttgcatacgtggcacattataactgaaccaa |
123730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 179 - 240
Target Start/End: Complemental strand, 16712590 - 16712529
Alignment:
| Q |
179 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||| |||||||||||| |||||| |
|
|
| T |
16712590 |
aaatagtccctgacgccacttttgtgatgatttgcatatgtggcacattataacttaaccaa |
16712529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 2180471 - 2180411
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||| || |||||||| |
|
|
| T |
2180471 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgagacatgatgactgaacc |
2180411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 18205256 - 18205316
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
18205256 |
gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgatacattatagctgaac |
18205316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 46087860 - 46087921
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46087860 |
gaaaatagtccctgatcccatttttgtgatgatttgcatacgtg--acattataactgaaccaa |
46087921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 5063105 - 5063164
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||| ||| ||||||||||| |
|
|
| T |
5063105 |
gaaaatagtccttgaccccacttttgtgatgatttgcatatgtggcacgttataactgaa |
5063164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35763853 - 35763790
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
35763853 |
gaaaatagtcccttaccccaattttgtgatgatttacatacgtagcacattataactgaaccaa |
35763790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 22099809 - 22099749
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
22099809 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
22099749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 182 - 238
Target Start/End: Complemental strand, 45505786 - 45505730
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
45505786 |
tagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
45505730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 45593328 - 45593387
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
45593328 |
aaaatagtccctgacccca-ttttgtgatgatttgcatacgtggcacatgatgactgaacc |
45593387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 50822178 - 50822134
Alignment:
| Q |
196 |
acttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50822178 |
acttttgtgatgatttgcatacgtggcacattataactgaaccaa |
50822134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 51545868 - 51545808
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
51545868 |
aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
51545808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 11692870 - 11692924
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||| || |||||||| |
|
|
| T |
11692870 |
gtccctgaccccacttttgtgatgattttcatacgtggcacatgatgactgaacc |
11692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 12791865 - 12791811
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
12791865 |
gtccctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
12791811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 7642544 - 7642491
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
7642544 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
7642491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 32365196 - 32365244
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
32365196 |
aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacat |
32365244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 189 - 233
Target Start/End: Original strand, 52429825 - 52429869
Alignment:
| Q |
189 |
tgaccccacttttgtgatgatttgcatacgtgacacattataact |
233 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52429825 |
tgaccccatttttgtgatgatttgcatacgtggcacattataact |
52429869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 52441862 - 52441922
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||| | || |||||||| |
|
|
| T |
52441862 |
aaaatagtctttgaccccatttttgtgatgatttgcatacgtgacacgtgatgactgaacc |
52441922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 5797711 - 5797657
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
5797711 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
5797657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 5827764 - 5827806
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
5827764 |
gtccctgaccccacttttgtgatgatttgcatatgtggcacat |
5827806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 9289368 - 9289427
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9289368 |
gaaaatagtcccttaccccaattttgtgatgatttgcata----gcacattataactgaaccaa |
9289427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 13530488 - 13530542
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
13530488 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
13530542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 224
Target Start/End: Complemental strand, 14791759 - 14791717
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacac |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
14791759 |
tagtccctgaccccacttttgtgatgatttgcacacttgacac |
14791717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 25424203 - 25424149
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
25424203 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
25424149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 46292441 - 46292483
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46292441 |
gtccctgcccccacttttgtgatgatttgcacacgtgacacat |
46292483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 25358460 - 25358407
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| ||||| || ||||||| |
|
|
| T |
25358460 |
gtccctgaccccacttttgtgatgatttgaacacgtggcacatgatgactgaac |
25358407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 29420436 - 29420387
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
29420436 |
gaaaatagtctctaaccccacttttgtgatgatatgcatacgtggcacat |
29420387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 50754146 - 50754094
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||| || ||||||| |
|
|
| T |
50754146 |
gtccctgaccccacttttgtgatgattt-cacacgtgacacatgatgactgaac |
50754094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 51738362 - 51738309
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
51738362 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
51738309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 102
Target Start/End: Complemental strand, 10078308 - 10078252
Alignment:
| Q |
46 |
atagggaaatataattatttagaggatatattatttgctttatatgatatgaaacat |
102 |
Q |
| |
|
||||||| ||| | |||||||| ||||||| ||||| |||||||||||||||||||| |
|
|
| T |
10078308 |
atagggagataaagttatttaggggatatactattttctttatatgatatgaaacat |
10078252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 239
Target Start/End: Original strand, 19321682 - 19321734
Alignment:
| Q |
187 |
cctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
|||||| ||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
19321682 |
cctgactccacttttgtgataatttgcacacgtgacacatgatgactgaacca |
19321734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 236
Target Start/End: Complemental strand, 54903359 - 54903315
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
54903359 |
ccccacttttgtgatgatttgcaagcgtgacacataataactgaa |
54903315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 217
Target Start/End: Original strand, 11285605 - 11285644
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatac |
217 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
11285605 |
aaaatagtctctgaccccatttttgtgatgatttgcatac |
11285644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 239
Target Start/End: Complemental strand, 42848282 - 42848227
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||| ||||| || ||||||||| |
|
|
| T |
42848282 |
gtccctgactccacttttgtgataatttgcacacgtgtcacatgatgactgaacca |
42848227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 239
Target Start/End: Original strand, 47135887 - 47135942
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||| |
|
|
| T |
47135887 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacca |
47135942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 4211610 - 4211652
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
4211610 |
gtccctggccccacttttgtgatgatttgcacacgtggcacat |
4211652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 226
Target Start/End: Complemental strand, 20292205 - 20292167
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
20292205 |
ctgactccacttttgtgatgatttgcacacgtgacacat |
20292167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 24774318 - 24774264
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
24774318 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
24774264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 226
Target Start/End: Original strand, 31182238 - 31182276
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
31182238 |
ctgaccccacttttgtaatgatttgcacacgtgacacat |
31182276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 31812032 - 31812086
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | |||||||| |||||||||||| ||||||||||| || |||||||| |
|
|
| T |
31812032 |
gtccctggctccacttttatgatgatttgcacacgtgacacatgatgactgaacc |
31812086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 36050395 - 36050449
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| || || || |||||||| |
|
|
| T |
36050395 |
gtccctggccccacttttgtgatgatttgcacacgtggcatatgatgactgaacc |
36050449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 51763093 - 51763039
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| |||||||| || || |||||||| |
|
|
| T |
51763093 |
gtccctggctccacttttgtgatgatttgcacacgtgacaaatgatgactgaacc |
51763039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 54208716 - 54208662
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
54208716 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
54208662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 220
Target Start/End: Complemental strand, 8191288 - 8191244
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttt--tgtgatgatttgcatacgtg |
220 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
8191288 |
aaaatagtccctgaccccactatattgtgatgatttgcatacgtg |
8191244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 14488078 - 14488025
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||| ||| ||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
14488078 |
gtccctgacaccaattttgtgatgatttgcacacgtggcacatgatgactgaac |
14488025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 238
Target Start/End: Original strand, 41439902 - 41439951
Alignment:
| Q |
189 |
tgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
41439902 |
tgaccctacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
41439951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Complemental strand, 5203174 - 5203130
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| || |||||||| |
|
|
| T |
5203174 |
ccacttttgtgatgatttgcacatgtgacacatgatgactgaacc |
5203130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 29380717 - 29380769
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||| |||||||||||| |||||||||| ||||| ||||| || |||||| |
|
|
| T |
29380717 |
gtccctggccccacttttgtaatgatttgcacacgtggcacatgatgactgaa |
29380769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 43368566 - 43368614
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| |||||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
43368566 |
aaaatagtcgttgaccccatttttatgatgatttgcatacgtggcacat |
43368614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 52543620 - 52543568
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| ||||| ||||| || |||||| |
|
|
| T |
52543620 |
gtccatgaccccacttttctgatgatttgcacacgtgtcacatgatgactgaa |
52543568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 64; Significance: 6e-28; HSPs: 89)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 275543 - 275606
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
275543 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
275606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 20907356 - 20907293
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20907356 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
20907293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 39288798 - 39288735
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39288798 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
39288735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 12673904 - 12673841
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12673904 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
12673841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 13584105 - 13584168
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13584105 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
13584168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 16123242 - 16123305
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16123242 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
16123305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 19656802 - 19656739
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19656802 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
19656739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 22156031 - 22156094
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22156031 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
22156094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 26799990 - 26800053
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26799990 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
26800053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 30004554 - 30004617
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30004554 |
gaaaatagtccctgaccccacttttgtgatgatttgcatgcgtgacacattataactgaaccaa |
30004617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 37506968 - 37507031
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37506968 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
37507031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 45161213 - 45161276
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45161213 |
gaaaatagtccctgacaccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
45161276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 45320879 - 45320816
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45320879 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa |
45320816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 29446057 - 29446119
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29446057 |
aaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
29446119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 3152010 - 3151947
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3152010 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
3151947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 4950266 - 4950203
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4950266 |
gaaaataggccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
4950203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 8510316 - 8510379
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8510316 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
8510379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 10977079 - 10977142
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10977079 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaa |
10977142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 20757500 - 20757563
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
20757500 |
gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa |
20757563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 21159715 - 21159652
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21159715 |
gaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
21159652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 29955400 - 29955463
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
29955400 |
gaaaatagtccctgaccccacttttgtgatgatttgcattcgtgtcacattataactgaaccaa |
29955463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 39072112 - 39072049
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
39072112 |
gaaaatagtccctgaccccacttttgtgataatttgcatacgtggcacattataactgaaccaa |
39072049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 39437007 - 39436944
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
39437007 |
gaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaa |
39436944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 51834841 - 51834778
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51834841 |
gaaaatagtccctgaccccactattgtgatgatttgcatacgtgacacattataacggaaccaa |
51834778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 5345587 - 5345525
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5345587 |
aaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
5345525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 179 - 237
Target Start/End: Complemental strand, 20612796 - 20612738
Alignment:
| Q |
179 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20612796 |
aaatagcccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
20612738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 47901901 - 47901963
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47901901 |
gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaacca |
47901963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 7518346 - 7518287
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7518346 |
gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattataactgaa |
7518287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 10778631 - 10778568
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
10778631 |
gaaaatagtccctgaccctacttttgtgatgatttgcatatgtggcacattataactgaaccaa |
10778568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 14633786 - 14633723
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
14633786 |
gaaaatagtccctaaccccacttttgtgaagatttgcatacgtggcacattataactgaaccaa |
14633723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 28427507 - 28427444
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
28427507 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacatggcacattataactgaaccaa |
28427444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 30130258 - 30130321
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30130258 |
gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattatagctgaaccaa |
30130321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 34238699 - 34238762
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34238699 |
gaaaatagtccctgactccacttttgagatgatttgcatacgtggcacattataactgaaccaa |
34238762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 40169552 - 40169493
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
40169552 |
gaaaatagtccctgaccccacttttgtgatgattcgcatacgtggcacattataactgaa |
40169493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 189 - 240
Target Start/End: Complemental strand, 49670725 - 49670674
Alignment:
| Q |
189 |
tgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49670725 |
tgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
49670674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 9863303 - 9863239
Alignment:
| Q |
177 |
gaaaatagtccctgaccccactttt-gtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9863303 |
gaaaatagtccctgacaccactttttgtgatgatttgcatacgtgacacattataattgaaccaa |
9863239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 18175889 - 18175951
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18175889 |
aaaatagtccctgaccttatttttgtgatgatttgcatacgtggcacattataactgaaccaa |
18175951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 3830232 - 3830292
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
3830232 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaac |
3830292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 4513519 - 4513459
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
4513519 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
4513459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 30268585 - 30268645
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
30268585 |
aaaatagttcctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc |
30268645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 51500584 - 51500536
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51500584 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacat |
51500536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 25710771 - 25710708
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
25710771 |
gaaaatagtctctgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaa |
25710708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 31869856 - 31869793
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
31869856 |
gaaaatagtccatgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaa |
31869793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 30426175 - 30426121
Alignment:
| Q |
186 |
ccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
30426175 |
ccctgaccccatttttgtgatgatttgcatatgtgacacattataactaaaccaa |
30426121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 45521650 - 45521712
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
|||||||||| || | |||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521650 |
gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaacca |
45521712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 46186669 - 46186620
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
46186669 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat |
46186620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 7957118 - 7957062
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||| || |||||||||| |
|
|
| T |
7957118 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaa |
7957062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 15016645 - 15016597
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
15016645 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat |
15016597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 51759922 - 51759970
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
51759922 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat |
51759970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 50261839 - 50261777
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
50261839 |
gaaaatagtctctgactccacttttgtgatgatttgcatgc-tggcacattataactgaaccaa |
50261777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 20405110 - 20405060
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
20405110 |
ctgactccacttttgtgatgatttgcatacgtgacacatgatgactgaacc |
20405060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 40277931 - 40277985
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
40277931 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
40277985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 195 - 237
Target Start/End: Original strand, 40979479 - 40979521
Alignment:
| Q |
195 |
cacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40979479 |
cacttttgtgatgatttgcatacgtgtcacattataactgaac |
40979521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 179 - 237
Target Start/End: Original strand, 50196401 - 50196459
Alignment:
| Q |
179 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
50196401 |
aaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaac |
50196459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 4814799 - 4814751
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||| ||||| |
|
|
| T |
4814799 |
aaaatagtccctgacctcatttttgtgatgatttgcatacgtggcacat |
4814751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 28942627 - 28942674
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacaca |
225 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
28942627 |
aaaatagtctctgatcccacttttgtgatgatttgcatacgtggcaca |
28942674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 237
Target Start/End: Original strand, 46901203 - 46901261
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||| ||||||||||| || |||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
46901203 |
aaaaaagtccctgacctcattttt-tgatgatttgcatacgtgacacatgataactgaac |
46901261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 4034826 - 4034880
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
4034826 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
4034880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 9262045 - 9261991
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
9262045 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
9261991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 36673072 - 36673114
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
36673072 |
gtccctgaccccacttttgtgatgatttacatacgtggcacat |
36673114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 45005995 - 45006049
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
45005995 |
gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
45006049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 47114701 - 47114651
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
47114701 |
ctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
47114651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 53701461 - 53701523
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||| || || |||||| ||||||||||||||||||||||| ||||| || |||||||||| |
|
|
| T |
53701461 |
aaaataatctctaaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaa |
53701523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 238
Target Start/End: Original strand, 54767284 - 54767334
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
54767284 |
ctgaccccacttttgtgatgatttgctcacgtgacacatgatgactgaacc |
54767334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 225
Target Start/End: Complemental strand, 8555199 - 8555158
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacaca |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
8555199 |
gtccctgaccccacttttgtgatgatttgcacacgtgtcaca |
8555158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 9603738 - 9603791
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
9603738 |
gtccctgactccacttttgtgatgatttgcacacgtgtcacatgatgactgaac |
9603791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 185 - 238
Target Start/End: Complemental strand, 38232498 - 38232445
Alignment:
| Q |
185 |
tccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| |||||||||||||||||| | ||||||||||| || |||||||| |
|
|
| T |
38232498 |
tccctgacctcacttttgtgatgatttgtacacgtgacacatgatgactgaacc |
38232445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 39132798 - 39132745
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||| ||| || ||||||| |
|
|
| T |
39132798 |
gtccctggccccacttttgtgatgatttgcacacgtgacgcatgatgactgaac |
39132745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 15286402 - 15286354
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
15286402 |
aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacat |
15286354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 30552246 - 30552306
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||| | |||| |||||||||||||||||| ||||| || |||||||| |
|
|
| T |
30552246 |
aaaatagtcactgaccctatttttatgatgatttgcatacgtggcacatgatgactgaacc |
30552306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 237
Target Start/End: Original strand, 51058703 - 51058751
Alignment:
| Q |
189 |
tgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| || ||||||| |
|
|
| T |
51058703 |
tgactccacttttgtgatgatttgcatatgtgacacatgatgactgaac |
51058751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 52342473 - 52342421
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || |||||| |
|
|
| T |
52342473 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
52342421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 223
Target Start/End: Original strand, 27681426 - 27681465
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgaca |
223 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
27681426 |
gtccctgatcccacttttgtgatgatttgcacacgtgaca |
27681465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 36732750 - 36732801
Alignment:
| Q |
187 |
cctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||| ||||| || |||||||| |
|
|
| T |
36732750 |
cctgaccccacttttgtgatgatttgcacatgtggcacatgatgactgaacc |
36732801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 179 - 238
Target Start/End: Complemental strand, 45313759 - 45313700
Alignment:
| Q |
179 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||| ||| | ||| || |||||||| |
|
|
| T |
45313759 |
aaatagtccctggccccacttttgtgatgatttgtatatgtggcgcatgatgactgaacc |
45313700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 2486785 - 2486739
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
2486785 |
ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
2486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 9596986 - 9596932
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||| ||||||||||||||||| ||||| || |||||||| |
|
|
| T |
9596986 |
gtccctgtctccacttttgagatgatttgcatacgtggcacatgatgactgaacc |
9596932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 240
Target Start/End: Complemental strand, 30034353 - 30034307
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||||| |
|
|
| T |
30034353 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaa |
30034307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 191 - 237
Target Start/End: Original strand, 35533393 - 35533439
Alignment:
| Q |
191 |
accccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
35533393 |
accccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
35533439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 50009029 - 50009071
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
50009029 |
gtccatgaccccacttttgtgatgatttgcacacgtggcacat |
50009071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 52956591 - 52956537
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | |||||||||||||||||| || ||||||||||| || |||||||| |
|
|
| T |
52956591 |
gtccctggctccacttttgtgatgatttacacacgtgacacatgatgactgaacc |
52956537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 238
Target Start/End: Original strand, 53113496 - 53113546
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||||||| || || ||||| || |||||||| |
|
|
| T |
53113496 |
ctgaccccacttttgtgatgatttgcacacatggcacatgatgactgaacc |
53113546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 236
Target Start/End: Original strand, 28418653 - 28418702
Alignment:
| Q |
187 |
cctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||| ||||| || |||||| |
|
|
| T |
28418653 |
cctggccccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
28418702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 193 - 238
Target Start/End: Complemental strand, 44802496 - 44802451
Alignment:
| Q |
193 |
cccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| || |||||||| |
|
|
| T |
44802496 |
cccacttttgtgatgatttgcacacatgacacataatgactgaacc |
44802451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 182 - 238
Target Start/End: Complemental strand, 16679857 - 16679801
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||| || ||||||||||||||||| ||||| |||| || |||||||| |
|
|
| T |
16679857 |
tagtccctgacctcatttttgtgatgatttgcacacgtggcacaagatgactgaacc |
16679801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 35177374 - 35177418
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
35177374 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
35177418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 35565627 - 35565671
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
35565627 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
35565671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 198 - 238
Target Start/End: Original strand, 43440614 - 43440654
Alignment:
| Q |
198 |
ttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
43440614 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacc |
43440654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 188 - 236
Target Start/End: Complemental strand, 53719214 - 53719166
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||| |||| || |||||| |
|
|
| T |
53719214 |
ctgacctcacttttgtgatgatttgcacacgtgatacatgatgactgaa |
53719166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 6e-28; HSPs: 80)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 3679725 - 3679788
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3679725 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
3679788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 15335193 - 15335130
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15335193 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
15335130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 31258441 - 31258504
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31258441 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
31258504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 990188 - 990251
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
990188 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
990251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 2733285 - 2733348
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2733285 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
2733348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 12361112 - 12361175
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12361112 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
12361175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 13260087 - 13260150
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13260087 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
13260150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 18473373 - 18473436
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18473373 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
18473436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 19622757 - 19622820
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19622757 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
19622820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 32454189 - 32454126
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32454189 |
gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa |
32454126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 41358562 - 41358499
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41358562 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
41358499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 45290559 - 45290621
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45290559 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
45290621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 4323930 - 4323993
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
4323930 |
gaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaa |
4323993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 7001795 - 7001732
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
7001795 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaa |
7001732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 17984595 - 17984532
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17984595 |
gaaaatagttcatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
17984532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 21391276 - 21391214
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21391276 |
gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactgaaccaa |
21391214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 32728948 - 32728885
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32728948 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
32728885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 48955964 - 48955901
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48955964 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
48955901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 24649452 - 24649514
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24649452 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
24649514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 178 - 239
Target Start/End: Complemental strand, 29688330 - 29688269
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29688330 |
aaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca |
29688269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 14007588 - 14007647
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
14007588 |
gaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaa |
14007647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 32626792 - 32626729
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
32626792 |
gaaaatagtccctgaccccacttttgtgatgatttacatacgtggcacaatataactgaaccaa |
32626729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 34383047 - 34383110
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34383047 |
gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaa |
34383110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35308009 - 35307946
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35308009 |
gaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaa |
35307946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 41881195 - 41881258
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||| |
|
|
| T |
41881195 |
gaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataacttaaccaa |
41881258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 44641333 - 44641271
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44641333 |
gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtggcacattataactgaaccaa |
44641271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 18302281 - 18302219
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18302281 |
aaaatagtctctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
18302219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 177 - 239
Target Start/End: Complemental strand, 50429108 - 50429047
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50429108 |
gaaaatagtccctgaccccacttt-gtgatgatttgcttacgtgacacattataactgaacca |
50429047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 46868329 - 46868389
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
46868329 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc |
46868389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1159739 - 1159676
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||| ||| ||||||||||||||| |
|
|
| T |
1159739 |
gaaaatagtccctgaccccacttttatgatgatttgcatatgtggcacgttataactgaaccaa |
1159676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 10552212 - 10552149
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
10552212 |
gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaa |
10552149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 21383203 - 21383266
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
21383203 |
gaaaatagtccctaaccccacttttgtgattatttgcatatgtggcacattataactgaaccaa |
21383266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 26062058 - 26062117
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26062058 |
gaaaatagtacatgaccccacttttgtgatgatttgcatacgtggcacattataactgaa |
26062117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 4360370 - 4360432
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
4360370 |
aaaatagtccctgaccgcacttttgtgctgatttgcatacgtggcgcattataactgaaccaa |
4360432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 182 - 240
Target Start/End: Original strand, 35005491 - 35005549
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35005491 |
tagtccctgaccctagttttgtgatgatttgcatacgtggcacattataactgaaccaa |
35005549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 1811170 - 1811109
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
1811170 |
gaaaatagtccctgactccatttttgtgatgatttgcatacgtgacacatgatgactgaacc |
1811109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 22919783 - 22919844
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
22919783 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
22919844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 26191459 - 26191520
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
26191459 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
26191520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 18900033 - 18899973
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
18900033 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
18899973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 26442797 - 26442736
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26442797 |
gaaaatagtccc--acaccacttttgtgatgatttgcatatgtgacacattataactgaaccaa |
26442736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 33067629 - 33067569
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
33067629 |
aaaatagtccctgaccccacctttgtgatgatttgcatacgtggcacatgatgactgaacc |
33067569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 7819001 - 7818938
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||| | | ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7819001 |
gaaaatagtccctgaccatattcttgtgatgatttgcatacgtggcacattataactgaaccaa |
7818938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 33379989 - 33380051
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || || ||||||| |
|
|
| T |
33379989 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgaccgaaccaa |
33380051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 48730509 - 48730455
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
48730509 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
48730455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 8364867 - 8364814
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
8364867 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaac |
8364814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 13770590 - 13770639
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
13770590 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat |
13770639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 179 - 240
Target Start/End: Complemental strand, 22953454 - 22953393
Alignment:
| Q |
179 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| ||||||||||| ||||||||| |||||| |
|
|
| T |
22953454 |
aaatagtccctggccctacttttgtgatgatttacatacgtgacatattataacttaaccaa |
22953393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 16083154 - 16083214
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
16083154 |
aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
16083214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 11822104 - 11822165
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||| ||||| ||||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
11822104 |
gaaagtagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
11822165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 20756120 - 20756169
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
20756120 |
gaaaatagtccctgaccctatttttgtgatgatttgcatacgtggcacat |
20756169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 26142521 - 26142557
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26142521 |
gaaaatagtccctgaccccacttttgtgatgatttgc |
26142557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 34808296 - 34808356
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
34808296 |
aaaatagtcaatgaccccatttttgtgatgatttgcatacgtggcacataatgactgaacc |
34808356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 37545850 - 37545790
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||| ||||||| ||||||||| ||||||||||||| ||||| || |||||||| |
|
|
| T |
37545850 |
aaaatagtccccgaccccatttttgtgataatttgcatacgtgccacatgatgactgaacc |
37545790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 48609493 - 48609445
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
48609493 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacat |
48609445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 52254283 - 52254343
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||||||||||| ||||| || |||||||| |
|
|
| T |
52254283 |
aaaatagtccctgaccccatttttattatgatttgcatacgtggcacatgatgactgaacc |
52254343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 29072600 - 29072647
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacaca |
225 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
29072600 |
aaaatagtccctgaccccatttttgtgatgattcgcatacgtggcaca |
29072647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 45368749 - 45368702
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacaca |
225 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
45368749 |
aaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcaca |
45368702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 201 - 240
Target Start/End: Original strand, 49226361 - 49226400
Alignment:
| Q |
201 |
tgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49226361 |
tgtgatgatttgcatacgtggcacattataactgaaccaa |
49226400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 19198836 - 19198786
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| ||||| ||||| |
|
|
| T |
19198836 |
ctgaccccacttttgtgatgatttgcacacgtggcacatgataacggaacc |
19198786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 24510051 - 24510105
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| ||||| || |||||||| |
|
|
| T |
24510051 |
gtccctgaccccacttttgtgatgatttgcagatgtggcacatgatgactgaacc |
24510105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 189 - 239
Target Start/End: Complemental strand, 42483217 - 42483167
Alignment:
| Q |
189 |
tgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||| || ||||||||| |
|
|
| T |
42483217 |
tgaccccacttttgtgatgatttgcacacgtgtcacatgatgactgaacca |
42483167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 49073944 - 49073902
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
49073944 |
gtccctgaccccacttttgtgatgatttgcacacgtgtcacat |
49073902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 188 - 240
Target Start/End: Original strand, 18927890 - 18927942
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| ||||| || |||||||||| |
|
|
| T |
18927890 |
ctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaaccaa |
18927942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Original strand, 27521676 - 27521724
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||| | || ||||||||||||||||||||||| ||||| |
|
|
| T |
27521676 |
aaaatagtccctgatctcatttttgtgatgatttgcatacgtggcacat |
27521724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 236
Target Start/End: Complemental strand, 51986459 - 51986415
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
51986459 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaa |
51986415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 292959 - 293002
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtg |
220 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
292959 |
gaaaatagtccatagccccacttttgtgatgatttgcatacgtg |
293002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 239
Target Start/End: Complemental strand, 10631419 - 10631364
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||| ||||| || ||||||||| |
|
|
| T |
10631419 |
gtccctgactccacttttgtgataatttgcacacgtgtcacatgatgactgaacca |
10631364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 235
Target Start/End: Complemental strand, 26324838 - 26324787
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactga |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||| || || ||||| || ||||| |
|
|
| T |
26324838 |
gtccctgaccccacttttgtgatgatttgcacacatgtcacataatgactga |
26324787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 220
Target Start/End: Original strand, 3753312 - 3753354
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtg |
220 |
Q |
| |
|
||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3753312 |
aaaatggtccttgaccccatttttgtgatgatttgcatacgtg |
3753354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 4789417 - 4789471
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| ||||| || |||||||| |
|
|
| T |
4789417 |
gtccctgaccccacttttgtgatgatttaaacacgtggcacatgatgactgaacc |
4789471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 10887342 - 10887396
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
10887342 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
10887396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 214
Target Start/End: Original strand, 12360712 - 12360742
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12360712 |
gtccctgaccccacttttgtgatgatttgca |
12360742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 16060704 - 16060758
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
16060704 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
16060758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 17129975 - 17129921
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| || || || |||||||| |
|
|
| T |
17129975 |
gtccctgactccacttttgtgatgatttgcacacgtggcagatgatgactgaacc |
17129921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 18079516 - 18079562
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
18079516 |
ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
18079562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 32035678 - 32035632
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| || |||||||| |
|
|
| T |
32035678 |
ccccacttttgtgatgatttgtacacgtgacacatgatgactgaacc |
32035632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 220
Target Start/End: Original strand, 32420208 - 32420242
Alignment:
| Q |
186 |
ccctgaccccacttttgtgatgatttgcatacgtg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32420208 |
ccctgaccccacttttgtgatgatttgcacacgtg |
32420242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 188 - 240
Target Start/End: Original strand, 12322718 - 12322770
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||| |||||||||||| | ||| ||||| |||| |||||||| |
|
|
| T |
12322718 |
ctgaccccacttttatgatgatttgcacatgtggcacatgataattgaaccaa |
12322770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 19720965 - 19720913
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||| ||||| || |||||| |
|
|
| T |
19720965 |
gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaa |
19720913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 24977898 - 24977942
Alignment:
| Q |
194 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
24977898 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
24977942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 72)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 38731929 - 38731991
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38731929 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
38731991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 8046430 - 8046493
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046430 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
8046493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 19183884 - 19183947
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19183884 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
19183947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 23989937 - 23990000
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23989937 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
23990000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 26814127 - 26814064
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26814127 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
26814064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 38980152 - 38980089
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38980152 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
38980089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 41693901 - 41693838
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41693901 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattacaactgaaccaa |
41693838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 41791119 - 41791178
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41791119 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
41791178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 44985722 - 44985785
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44985722 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacgttataactgaaccaa |
44985785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 3838162 - 3838099
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3838162 |
gaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
3838099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 5790797 - 5790734
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5790797 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
5790734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 7814505 - 7814442
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7814505 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaa |
7814442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 7814638 - 7814575
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7814638 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaa |
7814575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 24483632 - 24483695
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24483632 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
24483695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 37272001 - 37271938
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37272001 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
37271938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 40302077 - 40302140
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
40302077 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactcaaccaa |
40302140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 40786561 - 40786624
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40786561 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa |
40786624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 17541674 - 17541612
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17541674 |
aaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
17541612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 16899996 - 16900056
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16899996 |
gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
16900056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 16993387 - 16993447
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16993387 |
gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac |
16993447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 26707972 - 26708032
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26707972 |
gaaaatagtccctgaatccacttttgtgatgatttgcatacgtgacacattataactgaac |
26708032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 177 - 237
Target Start/End: Original strand, 43710480 - 43710540
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43710480 |
gaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaac |
43710540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 12835427 - 12835490
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
12835427 |
gaaaatagtccctgaccctacttttgtgatgatttgcatacgtggcacattataacggaaccaa |
12835490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 22881869 - 22881806
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
22881869 |
gaaaatagtccctaaccccacttttgtgatgatttgcatacgtgtcacattataactaaaccaa |
22881806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 25954325 - 25954262
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25954325 |
gaaaatagtccctaactccacttttgtgatgatttgcatacgtaacacattataactgaaccaa |
25954262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 26238912 - 26238975
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
26238912 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacataataactgaaccaa |
26238975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 31225817 - 31225879
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31225817 |
gaaaatagtccttgaccccacttttgtgatgatttgca-acgtgacacattataactgaaccaa |
31225879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 43789090 - 43789027
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
43789090 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcatattatcactgaaccaa |
43789027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 44073705 - 44073642
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
44073705 |
gaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaa |
44073642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 24483500 - 24483562
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
24483500 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacatgataactgaaccaa |
24483562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 43597400 - 43597339
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
43597400 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc |
43597339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 177 - 237
Target Start/End: Complemental strand, 14393029 - 14392969
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||| |
|
|
| T |
14393029 |
gaaaatagtccctgaccccacttttgtgatgatttgtatatgtggcacattataactgaac |
14392969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 17912550 - 17912614
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgat-gatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||| |
|
|
| T |
17912550 |
gaaaatagtccctgaccccacttttgtgatagacttgcatacgggacacattataactgaaccaa |
17912614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 20658160 - 20658223
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||| |||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
20658160 |
gaaaataatccctgactccacttttgtgattatttgcatacgtggcacattataactgaaccaa |
20658223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 33732960 - 33733023
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||| |||||||| |||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33732960 |
gaaaatagttcctgaccctacttttatgatgatttgcatacgtggcacattataactgaaccaa |
33733023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1497843 - 1497780
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1497843 |
gaaaatagtccacaaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaa |
1497780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 10665084 - 10665143
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
10665084 |
gaaaatagtctctgaccccacttttgtgatgatttacatacgtggtacattataactgaa |
10665143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 11713743 - 11713680
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
11713743 |
gaaaatagtccctgacccaacttttgtggtgatttgcatacgtggcacattataattgagccaa |
11713680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 177 - 239
Target Start/End: Complemental strand, 19831694 - 19831632
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
239 |
Q |
| |
|
|||||||||| || | |||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19831694 |
gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaacca |
19831632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 43592146 - 43592195
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
43592146 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat |
43592195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 12820967 - 12820892
Alignment:
| Q |
29 |
aatagtggcagttacata--tagggaaatataattatttagaggatatattatttgctttatatgatatgaaacat |
102 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| |||||||| ||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
12820967 |
aatagtggcagttacataaatagggagatatagttatttaggggatatactattttcttcatatgatatgaaacat |
12820892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 45442415 - 45442475
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||| ||||| || |||||||| |
|
|
| T |
45442415 |
aaaatagtccctgaccccatttttgtgattatttgcatacgtggcacatgatgactgaacc |
45442475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 29865411 - 29865348
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29865411 |
gaaaatagtctctaaccaaacttttgtgatgatttgcatacgtgacacattaatactgaaccaa |
29865348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 31909370 - 31909316
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
31909370 |
gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
31909316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 32691413 - 32691474
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||| ||| | || |||||||| |
|
|
| T |
32691413 |
gaaaatggtccctgaccccatttttgtgatgatttgcatacgtggcacgtgatgactgaacc |
32691474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 31326149 - 31326101
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
31326149 |
aaaatagtcgctgaccccatttttgtgatgatttgcatacgtggcacat |
31326101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 3832388 - 3832434
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
3832388 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
3832434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 4042781 - 4042727
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
4042781 |
gtccctgacttcacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
4042727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 20939216 - 20939162
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| ||||| || |||||||| |
|
|
| T |
20939216 |
gtccctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaacc |
20939162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 23732220 - 23732166
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
23732220 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
23732166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 29182277 - 29182319
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
29182277 |
gtccctgactccacttttgtgatgatttgcacacgtgacacat |
29182319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 34317915 - 34317961
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
34317915 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
34317961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Original strand, 1138091 - 1138144
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
1138091 |
gtccccgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
1138144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 25750857 - 25750804
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
25750857 |
gtccttgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
25750804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 185 - 238
Target Start/End: Complemental strand, 44559299 - 44559246
Alignment:
| Q |
185 |
tccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||| |||||||| |||||||||||| ||||||||||| || |||||||| |
|
|
| T |
44559299 |
tccctgactccacttttctgatgatttgcacacgtgacacatgatgactgaacc |
44559246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 226
Target Start/End: Original strand, 13850635 - 13850671
Alignment:
| Q |
190 |
gaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13850635 |
gaccccacttttgtgatgatttgcacacgtgacacat |
13850671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 44993957 - 44993909
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
44993957 |
aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacat |
44993909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 195 - 238
Target Start/End: Complemental strand, 5164376 - 5164333
Alignment:
| Q |
195 |
cacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
5164376 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
5164333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 217
Target Start/End: Original strand, 36622349 - 36622388
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatac |
217 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
36622349 |
aaaatagtccatgaccccatttttgtgatgatttgcatac |
36622388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 4424004 - 4424058
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
4424004 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
4424058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 4842940 - 4842994
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| |||||||||||||||||| || ||||| ||||| || |||||||| |
|
|
| T |
4842940 |
gtccctgactccacttttgtgatgattttcacacgtggcacatgatgactgaacc |
4842994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 16523098 - 16523152
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
16523098 |
gtccctggcgccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
16523152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 27109151 - 27109205
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
27109151 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
27109205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 34964044 - 34963998
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| || |||||||| |
|
|
| T |
34964044 |
ccccacttttgtaatgatttgcacacgtgacacatgatgactgaacc |
34963998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 214
Target Start/End: Original strand, 37228831 - 37228861
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37228831 |
gtccctgaccccacttttgtgatgatttgca |
37228861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 40125075 - 40125129
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
40125075 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
40125129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 226
Target Start/End: Original strand, 42695985 - 42696019
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42695985 |
ccccacttttgtgatgatttgcacacgtgacacat |
42696019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 43672041 - 43672095
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| ||||| ||||| || |||||||| |
|
|
| T |
43672041 |
gtccctggccccacttttgtgattatttgcacacgtggcacatgatgactgaacc |
43672095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 11788166 - 11788214
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||| |||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
11788166 |
ctgacccc-cttttgtgatgatttgcacatgtgacacatgataactgaac |
11788214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 237
Target Start/End: Complemental strand, 1295437 - 1295385
Alignment:
| Q |
185 |
tccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | ||| ||||| || ||||||| |
|
|
| T |
1295437 |
tccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaac |
1295385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 10374972 - 10374913
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgac-acattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
10374972 |
gaaaatagtccctgaccc-----ttgtgataatttgcatacgtggccacattataactgaaccaa |
10374913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 236
Target Start/End: Complemental strand, 36815713 - 36815673
Alignment:
| Q |
196 |
acttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
36815713 |
acttttgtgatgatttgcacacgtgacacatgatgactgaa |
36815673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 188 - 125
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
188 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 10257 - 10320
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10257 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa |
10320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 5311 - 5374
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5311 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
5374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 5331 - 5394
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5331 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
5394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 8649 - 8712
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8649 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
8712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 14797 - 14860
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14797 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
14860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 35170 - 35107
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35170 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
35107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 17942 - 17879
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
17942 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgtcactttataactgaaccaa |
17879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 12284 - 12347
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
12284 |
gaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaa |
12347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 1542 - 1479
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
1542 |
gaaaatagtctctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaa |
1479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 8926 - 8864
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8926 |
gaaaatagtccctgaccccacttt-gtgatgatttgcatacgtggcacattataactgaaccaa |
8864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 5605 - 5542
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5605 |
gaaaatagtccccgaccccacgtttgtgatgatttgcatacgtggcacattataactgaaccaa |
5542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 4211 - 4149
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
4211 |
aaaatagaccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaa |
4149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 236
Target Start/End: Complemental strand, 3191 - 3132
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
236 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3191 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggtacattataactgaa |
3132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 8432 - 8493
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||| ||||| || |||||||| |
|
|
| T |
8432 |
gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacc |
8493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 94160 - 94220
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
94160 |
aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc |
94220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 178 - 238
Target Start/End: Complemental strand, 366174 - 366114
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||| ||||| || |||||||| |
|
|
| T |
366174 |
aaaatagtccccgaccccatttttgtgatgatttgtatacgtggcacatgatgactgaacc |
366114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 4128 - 4175
Alignment:
| Q |
186 |
ccctgaccccacttttgtgatgatttgcatacgtgacacattataact |
233 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
4128 |
ccctgaccccacttctgggatgatttgcatacgtggcacattataact |
4175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 19310 - 19357
Alignment:
| Q |
186 |
ccctgaccccacttttgtgatgatttgcatacgtgacacattataact |
233 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
19310 |
ccctgaccccacttctgggatgatttgcatacgtggcacattataact |
19357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 24558 - 24495
Alignment:
| Q |
177 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
|||||||||| ||||||| || ||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
24558 |
gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaa |
24495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 224
Target Start/End: Original strand, 47972 - 48014
Alignment:
| Q |
182 |
tagtccctgaccccacttttgtgatgatttgcatacgtgacac |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
47972 |
tagtccctgaccccacttttgtgatgatttgcacacttgacac |
48014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 225
Target Start/End: Original strand, 2878 - 2925
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacaca |
225 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| ||||||| |||| |
|
|
| T |
2878 |
aaaatagtccttgaccccatttttgtgatgatttgtatacgtggcaca |
2925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 2412 - 2458
Alignment:
| Q |
192 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
2412 |
ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc |
2458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 16832 - 16886
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||| | ||| ||||| || |||||||| |
|
|
| T |
16832 |
gtccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaacc |
16886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 34976 - 34922
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
238 |
Q |
| |
|
||||||| ||||||||| |||||||||||||| ||||||||| || |||||||| |
|
|
| T |
34976 |
gtccctggtcccacttttatgatgatttgcatatgtgacacatgatgactgaacc |
34922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 220
Target Start/End: Complemental strand, 17863 - 17819
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttt--tgtgatgatttgcatacgtg |
220 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
17863 |
aaaatagtccctgaccccactatattgtgatgatttgcatacgtg |
17819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 2615 - 2664
Alignment:
| Q |
188 |
ctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
237 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||| ||||| || ||||||| |
|
|
| T |
2615 |
ctgaccccacttttgtgattatttgcacacgtggcacatgatgactgaac |
2664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 3818 - 3770
Alignment:
| Q |
178 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacat |
226 |
Q |
| |
|
|||||||||||||| | || |||||| |||||||||||||||| ||||| |
|
|
| T |
3818 |
aaaatagtccctgatctcatttttgttatgatttgcatacgtggcacat |
3770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 82450 - 82506
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
240 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||| ||||| || ||| |||||| |
|
|
| T |
82450 |
gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaaccaa |
82506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 189437 - 189473
Alignment:
| Q |
184 |
gtccctgaccccacttttgtgatgatttgcatacgtg |
220 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
189437 |
gtccctggccccacttttgtgatgatttgcacacgtg |
189473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University