View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2889_low_19 (Length: 248)
Name: NF2889_low_19
Description: NF2889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2889_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 13878973 - 13878761
Alignment:
| Q |
1 |
tttcttgtataaaagactcgagggagtatttaatatgattttatgattttagctaactgaggagtgtagccgtaaattcgggaagaagagccaatgagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13878973 |
tttcttgtataaaagactcgagggagtatttaatatgattttatgattttagctaactgaggagtgtagccgtaaattcgggaagaagagccaatgagtt |
13878874 |
T |
 |
| Q |
101 |
attgaaattacaatatgatgatgagcgtaacaaatttatcgagtcgatacctaatttctggtaactttattcaatgttgagtatttgtgttcttctttaa |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13878873 |
attgaaattacaatatgatgatgggcgtaacaaatttatcgagtcgatacctaatttctggtaactttattcaatgttgagtatttatgttcttctttaa |
13878774 |
T |
 |
| Q |
201 |
atattttttgttg |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13878773 |
atattttttgttg |
13878761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University