View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2889_low_21 (Length: 223)
Name: NF2889_low_21
Description: NF2889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2889_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 34364970 - 34365164
Alignment:
| Q |
15 |
tactataatggaggattgaaattttgagttttgacattcc-atcatcaaacccttgtctgtctagattaggctcagtgttaactgacctacaagcatttt |
113 |
Q |
| |
|
|||| ||||||| ||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34364970 |
tactctaatggaagattgaaatattgagttttgacattcccatcatcaaacccctgtctgtctagattaggctcagtgttaactgacctacaagcatttt |
34365069 |
T |
 |
| Q |
114 |
gtcatatattcagttattccacaagttgtgtgacacttccctaagaataatatcatccatcataaaataaaaatgaaggtttctgatgacaagagt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
34365070 |
gtcatatattcagttattccacaagttgtgtgacacttccctaagaataatatcatccatcataaaa-aaaaatgaaggtttctgaagacaagagt |
34365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University