View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2890_high_15 (Length: 264)
Name: NF2890_high_15
Description: NF2890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2890_high_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 8475201 - 8474953
Alignment:
| Q |
19 |
gaattttctcactagtttggtgatttatcattggtgcatagaggttgttggatttggtgtattctctgtaatttatcatcagactttggacacttgtata |
118 |
Q |
| |
|
|||||| |||| | |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
8475201 |
gaatttcctcagttgtttggtgatttatcattggtgtatagaggttgttggcattggtgtattctctgtaattcatcatcagactttggactcttgtata |
8475102 |
T |
 |
| Q |
119 |
tagatacctatggcatttcttgtgcttggatatatctttattaataaatttctttagacctcttaag---nnnnnnnnncttagataaatgcaaacttaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8475101 |
tagatacctatggcatttcttgtgcttggatatatctttattaataaatttctttagacctcttaagaaagaaaaaaaacttagataaatgcaaacttaa |
8475002 |
T |
 |
| Q |
216 |
ataaaacctttcacacttggcgtattcttttggatagaggactcaaatg |
264 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8475001 |
ataaaacctttcactcttggcgtattcttttggatagaggactcaaatg |
8474953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University