View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2890_high_18 (Length: 239)
Name: NF2890_high_18
Description: NF2890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2890_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 8621474 - 8621680
Alignment:
| Q |
19 |
gaggagaagcctcttcttcaaccatctgcataagggtcttcacttgacccctcagcaaggcttcaccagatcctggtgtgttcttcacacggcttcctct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8621474 |
gaggagaagcctcttcttcaaccatctgcataagggtcttcacttgacccctcagcaaggcttcaccagatcctggtgtgttcttcacacgacttcctct |
8621573 |
T |
|
| Q |
119 |
ttgtttcgcagacggtgtctcgagatttccaccagcaagaccaacaattggtgaatcatttgtcatgtccatcaatgcacatcgatcttgattttgttga |
218 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8621574 |
ttgtttcgcagatggtgtctcgagatttccaccagcaagaccaacaattggtgaatcatttgtcatgtccatcaatgcacatctatcttgattttgttga |
8621673 |
T |
|
| Q |
219 |
ccctttg |
225 |
Q |
| |
|
||||||| |
|
|
| T |
8621674 |
ccctttg |
8621680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 30 - 128
Target Start/End: Complemental strand, 32125710 - 32125612
Alignment:
| Q |
30 |
tcttcttcaaccatctgcataagggtcttcacttgacccctcagcaaggcttcaccagatcctggtgtgttcttcacacggcttcctctttgtttcgca |
128 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| ||||||| ||| ||||||||||| || || || |||||||| |||||||||||||| |||||| |
|
|
| T |
32125710 |
tcttcttcaactttctgcaaaagggtcttcacttgtcccctcaacaaagcttcaccagaaccaggagtcttcttcacccggcttcctctttgcttcgca |
32125612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University