View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2890_high_19 (Length: 239)
Name: NF2890_high_19
Description: NF2890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2890_high_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 239
Target Start/End: Original strand, 36588044 - 36588264
Alignment:
| Q |
20 |
taccagcagataatacaataatccttgaaagaaacataaaaga--gtaaaagttctataataatccacctgagcaggcgcacctggaggaagcatagaaa |
117 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36588044 |
taccagtagataattcaataatccttgaaagaaacataaaagaaagtaaaaattctataata-tccacctgagcaggcgcacctggaggaagcatagaaa |
36588142 |
T |
 |
| Q |
118 |
gaagaacttcacgaacaacttgttgttgctgcaaacgagaccgacgcaacattactcttttcgacacatccacaaaactctcataatcatactcccaaat |
217 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36588143 |
gaagaacctcacgaacaacttgctgttgctgcaaacgagaccgacgcaacattactcttttggacacatcaacaaaactctcataatcatactcccaaac |
36588242 |
T |
 |
| Q |
218 |
atccaaccaacctttcttttcc |
239 |
Q |
| |
|
||||||| |||| ||||||||| |
|
|
| T |
36588243 |
atccaacaaacccttcttttcc |
36588264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University