View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2890_high_21 (Length: 227)
Name: NF2890_high_21
Description: NF2890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2890_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 87 - 212
Target Start/End: Complemental strand, 37503456 - 37503331
Alignment:
| Q |
87 |
tggattattgatgcatttttctaaagttgaggtatgcatgtgcatcccctgacttgtaggtggctccgccactggttgaactccattcttctactccttc |
186 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37503456 |
tggattattggtgcatttttctaaagttgaggtatgcatgtgcatcccctgacttgtaggtggctccgccactggttgaactccattcttctactccttc |
37503357 |
T |
 |
| Q |
187 |
atcccaattatttcatcccaaatatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37503356 |
atcccaattatttcatcccaaatatg |
37503331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 87 - 161
Target Start/End: Complemental strand, 33829902 - 33829827
Alignment:
| Q |
87 |
tggattattgatgcatttttctaaagttgag-gtatgcatgtgcatcccctgacttgtaggtggctccgccactgg |
161 |
Q |
| |
|
|||||||||| || ||||||| ||||||||| | ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33829902 |
tggattattggtgtatttttcaaaagttgagaggatgcatgtgcatcccctgacttgtacgtggctccgccactgg |
33829827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 50
Target Start/End: Complemental strand, 37503529 - 37503489
Alignment:
| Q |
9 |
gagtgagatgaaagtgcaaaaaaaagttgagggtatgcaatc |
50 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
37503529 |
gagtgagttgaaagtgcaaaaaaa-gttgagggtatgcaatc |
37503489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 160
Target Start/End: Original strand, 24857356 - 24857396
Alignment:
| Q |
120 |
atgcatgtgcatcccctgacttgtaggtggctccgccactg |
160 |
Q |
| |
|
|||||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
24857356 |
atgcatctgcatcccctcacttgtatgtggctccgccactg |
24857396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 87 - 160
Target Start/End: Complemental strand, 12470388 - 12470314
Alignment:
| Q |
87 |
tggattattgatgcatttttctaaagttgag-gtatgcatgtgcatcccctgacttgtaggtggctccgccactg |
160 |
Q |
| |
|
|||||||||| || ||||||| ||||||||| | ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12470388 |
tggattattggtgtatttttcaaaagttgagaggatgcatgtgcatcccctgacttgtacgtggctccgccactg |
12470314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 87 - 160
Target Start/End: Complemental strand, 34112808 - 34112734
Alignment:
| Q |
87 |
tggattattgatgcatttttctaaagttgag-gtatgcatgtgcatcccctgacttgtaggtggctccgccactg |
160 |
Q |
| |
|
|||||||||| || |||||| ||||||||| | ||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
34112808 |
tggattattggtgtattttttaaaagttgagaggatgcatgtgcatcccctaacttgtatgtggctccgccactg |
34112734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 12470465 - 12470425
Alignment:
| Q |
9 |
gagtgagatgaaagtgcaaaaaaaagttgagggtatgcaat |
49 |
Q |
| |
|
||||||| |||||||||||| ||| |||||||||||||||| |
|
|
| T |
12470465 |
gagtgagttgaaagtgcaaataaaggttgagggtatgcaat |
12470425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 34112884 - 34112844
Alignment:
| Q |
9 |
gagtgagatgaaagtgcaaaaaaaagttgagggtatgcaat |
49 |
Q |
| |
|
||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
34112884 |
gagtgagttgaaagtgcagataaaagttgagggtatgcaat |
34112844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 87 - 160
Target Start/End: Original strand, 34306544 - 34306618
Alignment:
| Q |
87 |
tggattattgatgcatttttctaaagttgag-gtatgcatgtgcatcccctgacttgtaggtggctccgccactg |
160 |
Q |
| |
|
|||||||||| || ||||||| ||||||||| | ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34306544 |
tggattattggtgtatttttcaaaagttgagaggatgcatgtgcatcccctgacttgtacgtggctccgccactg |
34306618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 163
Target Start/End: Complemental strand, 8366265 - 8366222
Alignment:
| Q |
120 |
atgcatgtgcatcccctgacttgtaggtggctccgccactggtt |
163 |
Q |
| |
|
|||||| |||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
8366265 |
atgcatctgcatcccctcacttgtatgtggctccgccactggtt |
8366222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 25267886 - 25267846
Alignment:
| Q |
120 |
atgcatgtgcatcccctgacttgtaggtggctccgccactg |
160 |
Q |
| |
|
|||||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
25267886 |
atgcatttgcatcccctcacttgtatgtggctccgccactg |
25267846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University