View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2890_low_17 (Length: 240)
Name: NF2890_low_17
Description: NF2890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2890_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 39764275 - 39764486
Alignment:
| Q |
20 |
ggactcaagtttgcttacatgcacagattttgcagcatcagctcttaacagctcgacagttcttttcgctgcctcaagttgtcgcaaagtctcgttcacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39764275 |
ggactcaagtttgcttacatgcacagattttgcagcatcagctcttaacagctcgacagttcttttcgctgcctcaagttgtcgcaaagtctcgttcacc |
39764374 |
T |
|
| Q |
120 |
aaaggttgagcctgatttgactctttgcaatcttggagctggttttccatgtttttcacaagagaaagtgattttgataacttgtgcctcaagttttgta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39764375 |
aaaggttgagcctgatttgactctttgcaatctcggagctggttttccatgtttttcacaagagaaagtgattttgataacttgtgcctcaagttttgta |
39764474 |
T |
|
| Q |
220 |
gttctgtgtctg |
231 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39764475 |
gttctgtgtctg |
39764486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 77 - 147
Target Start/End: Original strand, 39758632 - 39758702
Alignment:
| Q |
77 |
agttcttttcgctgcctcaagttgtcgcaaagtctcgttcaccaaaggttgagcctgatttgactctttgc |
147 |
Q |
| |
|
|||||||| ||| ||||| ||||||||||||||||| |||||||||||| |||||||| ||||||||||| |
|
|
| T |
39758632 |
agttctttccgcggcctcgagttgtcgcaaagtctcattcaccaaaggtcgagcctgaactgactctttgc |
39758702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University