View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2890_low_20 (Length: 227)
Name: NF2890_low_20
Description: NF2890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2890_low_20 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 47 - 227
Target Start/End: Original strand, 41028150 - 41028330
Alignment:
| Q |
47 |
ttaggttgtagttttgatttgaaactctgcatctgttgcaatgtctaaacaatgcaatttttccatttttgctaagtaatctgcaatgcaattgcgaata |
146 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41028150 |
ttaggttttagttttgatttgaaactctgcatctgttgcaatgtctaaacaatgcaatttttccatttttgctaagtaatctgcagtgcaattgcgaata |
41028249 |
T |
|
| Q |
147 |
acttattctctgcgattgaatgagatgttttgaaactgaggaaagaccaactagttttttctcaatggttcccatatgtta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41028250 |
acttattctctgcgattgaatgagatgttttgaaaccgaggaaagaccaactagttttttctcaatggttcccatatgtta |
41028330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University