View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2891_high_9 (Length: 213)
Name: NF2891_high_9
Description: NF2891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2891_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 12 - 197
Target Start/End: Complemental strand, 37252618 - 37252433
Alignment:
| Q |
12 |
gatgaaggtggtggagatggttgtccaatgtggtatgtgttgtttagtctcaataaagcccgatttatgttgcaaattgtgtatgtgctttggtgccaag |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37252618 |
gatgaaggtggtggagatggtggtccaatgtggtatgtgttgtttagtctcaataaagcccgatttatgttgcaaattgtgtatgtgctttggtgccaag |
37252519 |
T |
 |
| Q |
112 |
aaagatcttgtgcagttctgaaggtttcatggcaatggttgcatggaataagagcaacgttagtaatgatgctgctgccagtactg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37252518 |
aaagatcttgtgcagttctgaaggtttcatggcaatggttgcatggaataggagcaacgttagtaatgatgctgctgccagtactg |
37252433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 50 - 155
Target Start/End: Complemental strand, 37241355 - 37241250
Alignment:
| Q |
50 |
gttgtttagtctcaataaagcccgatttatgttgcaaattgtgtatgtgctttggtgccaagaaagatcttgtgcagttctgaaggtttcatggcaatgg |
149 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||| ||||||| | |||||||||| |
|
|
| T |
37241355 |
gttgttttgtctcgataaagcccgatttatgttgcaaattatgtatgagctttggtgccaagaaagatcttgcgcagttttgaaggtgttatggcaatgg |
37241256 |
T |
 |
| Q |
150 |
ttgcat |
155 |
Q |
| |
|
|||||| |
|
|
| T |
37241255 |
ttgcat |
37241250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 12 - 45
Target Start/End: Complemental strand, 37241448 - 37241415
Alignment:
| Q |
12 |
gatgaaggtggtggagatggttgtccaatgtggt |
45 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
37241448 |
gatgaaggtggtggagatggtggtccaatgtggt |
37241415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University