View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2892_low_14 (Length: 242)
Name: NF2892_low_14
Description: NF2892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2892_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 30789236 - 30789013
Alignment:
| Q |
1 |
tgttcttaaatcactttatatgggtccaaagatgacacatgtgtctttcaaaaatttcaacactttcactctgatgcaaaaattgagtttatgtttctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30789236 |
tgttcttaaatcactttatatgggtccaaagatgacacatgtgtctttcaaaaatttcaacactttcactctgatgcaaaaattgagtttatgtttctaa |
30789137 |
T |
|
| Q |
101 |
gtgggttccattaatgactttttggacaccccaaacccccactattctacttctatgggcacccctcccttttccctagtttttgtatcctacactttct |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30789136 |
gtgggttccattaatgactttttatacaccccaaacccccactatcctacttctatgggcacccctcccttttccctagtttttgtatcctacactttct |
30789037 |
T |
|
| Q |
201 |
actttttatactctagggacaact |
224 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
30789036 |
actttttatactctaggggcaact |
30789013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University