View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2892_low_17 (Length: 217)
Name: NF2892_low_17
Description: NF2892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2892_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 13 - 202
Target Start/End: Complemental strand, 6472067 - 6471878
Alignment:
| Q |
13 |
gtgagaagaatttggaggggtcaggaagaacagtggattgtatctgtgggaatagaaaggaactattctctttgttgttaggcattgcagctgataggat |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6472067 |
gtgagaagaatttggaggggtcagggagaacagtggattgtatctgtgggaatagaaaggaactattctctttgttgttaggcattgcagctgataggat |
6471968 |
T |
 |
| Q |
113 |
aatgatgaatgtcttaattattattgtggttttatagttttttaaggtatgtggtgagtgcaatttgtgtgttagattcttagtattttc |
202 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6471967 |
aatgatgaatgtcttaattatgattgtggttttatagttttttaaggtatgtggtgagtgcaatttttgtgttagattcttagtattttc |
6471878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 49
Target Start/End: Original strand, 6529352 - 6529386
Alignment:
| Q |
15 |
gagaagaatttggaggggtcaggaagaacagtgga |
49 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
6529352 |
gagaagaatttggaggggtcaggaaggacagtgga |
6529386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University