View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2892_low_4 (Length: 691)
Name: NF2892_low_4
Description: NF2892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2892_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 397 - 675
Target Start/End: Original strand, 9996929 - 9997206
Alignment:
| Q |
397 |
gcttaatatatgttataaattgcttatagtccaaatgatgtattaagcctctttatagaaccgggtcacgtgtacacaccgggtcgattgaataatcggg |
496 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9996929 |
gcttaatatatgttataaattgcttatagtccaaatgatgtattaagcctctttatagaactgggtcacgtgtacacactgggtcgattgaataatcggg |
9997028 |
T |
|
| Q |
497 |
tcaaaattggtaattttactaggattttgtc--ttttgtagagtggatggcaaaattttgcttgcagccaaccacatggagttaagcgtctttccaaccc |
594 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||| |
|
|
| T |
9997029 |
tcaaaattggtaattttactaggattttgtctgttttgtagagtggatggcaaaattttgcttacggccaaccacatggagttgagcgtctttccaaccc |
9997128 |
T |
|
| Q |
595 |
tccccttgaatgttctcctcttcgtttgcaagttgttatgggaactattattgttccctagcatattaaagtgtatttcct |
675 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9997129 |
tccccttggatgttctcctcttcgtttgcaagttgttatgggaac---tattgttccctagcatattaaagtgtatttcct |
9997206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 166; E-Value: 2e-88
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 9996035 - 9996223
Alignment:
| Q |
15 |
atgaagagaactatgtatgatttccaaaagcgagggagtgagaaatgtgacaatactatgtggtcactgtctaggtactaggtagtttaatgaggaatct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9996035 |
atgaagagaactatgtatgatttccaaaagcgagggagtgagaaatgtgacaatactatgtggtcactgtctaggtactaggtagtttaatgaggaatct |
9996134 |
T |
|
| Q |
115 |
tggctttctaatgcccttacaacagagatgtcatatgcgggtgatcactgcgtttgaggttatttggagcccgggctttcgtaaaaatatgacc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9996135 |
tggctttctaatgcccttacaacagagatg-----tgcgggcgatcactgcgtttgaggttatttggagctcgggctttcgtaaaaatatgacc |
9996223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 210 - 282
Target Start/End: Original strand, 9996688 - 9996760
Alignment:
| Q |
210 |
gatggtgttggtgaagcttatggttcatggttgtgtgccttctcacattgactattgatctgtgcacaagtga |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9996688 |
gatggtgttggtgaagcttatggttcatggttgtgtgccttctcacattgactattgatctgtgcacaagtga |
9996760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 308 - 336
Target Start/End: Original strand, 9996761 - 9996789
Alignment:
| Q |
308 |
gattttgtttcacgtagatagggacttat |
336 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9996761 |
gattttgtttcacgtagatagggacttat |
9996789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University