View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2892_low_8 (Length: 345)
Name: NF2892_low_8
Description: NF2892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2892_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 13 - 168
Target Start/End: Complemental strand, 30789717 - 30789562
Alignment:
| Q |
13 |
aagagagtgtaagttttatatctaaagagtcaaaaacagaaatttccaaacagtaaatatagtgtggaaaacaaaatttccagctaacactaaaactcga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30789717 |
aagagagtgtaagttttatatctaaagagtcaaaaacagaaatttccaaatagtaaatttagtgtggaaaacaaaatttccagttaacactaaaactcga |
30789618 |
T |
 |
| Q |
113 |
ggatttagaaaatggtcgccaaagtggaaacgatcttttgttgaaacaatattttc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30789617 |
ggatttagaaaatggtcgccaaagtggaaacgatcttttgttgaaacaatattttc |
30789562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 221 - 345
Target Start/End: Complemental strand, 30789508 - 30789384
Alignment:
| Q |
221 |
gttcaattgattctagacgaaatcacccaaatttctccttcgaggtggcgttggtgatcgattatcacccattatattatttgaatatttttctccttct |
320 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30789508 |
gttcaattgatttgagacgaaatcacccaaatttctccttcgaggtggcgttggtgatcgattatcacccattatattagttgaatatttttctccttct |
30789409 |
T |
 |
| Q |
321 |
tttggggtgatttcaattttcaata |
345 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30789408 |
tttggggtgatttcaattttcaata |
30789384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University