View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2893_low_5 (Length: 224)
Name: NF2893_low_5
Description: NF2893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2893_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 39429434 - 39429626
Alignment:
| Q |
17 |
cacaaactgcctgaaagaaaatttgtaccggttcgtttgagacggccatcgtcgtcgtgtgaaatcagctctccttcgatgtcgaaagttctaagtctgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
39429434 |
cacaaactgcctgaaagaaaatttgtaccggttcgtttgagacggccatcgtcgtcgtgtgaaatcagctctccttcgatgtcgaaagttctaaggctag |
39429533 |
T |
|
| Q |
117 |
ttgttgttggtgtcgcttttacagtcatcacgattcgatttggtggaataaaccaagtagaataagaggtatatgagtgtgacattatggtat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39429534 |
ttgttgttggtgtcgcttttacagtcatcacgattcgatttggtggaatgaaccaagtagaataagaggtatatgagtgtgacattatggtat |
39429626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University