View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2896_low_4 (Length: 270)
Name: NF2896_low_4
Description: NF2896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2896_low_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 41 - 270
Target Start/End: Complemental strand, 31581495 - 31581265
Alignment:
| Q |
41 |
acttgttggaccatatgctaaaaacc-atcaagagccaagagaatgctcacagtgaaccctgttcatttctgcttaacaccaatagaaatgaaattgtat |
139 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31581495 |
acttgttggaccatatgctaaaaacccatcaagagccaagagaatgctcacagtgaaccctgttcatttctgcttaacaccaatagaaattaaattgtat |
31581396 |
T |
 |
| Q |
140 |
gatcaacaaggtcggtgtgacacagcactggtagatttttggtaatggattttatccgtcaaattcgtgaataaattgttagtaaaagtcgacccttgaa |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
31581395 |
gatcaacaaggtcggtgtgacacagcactggtagatttttggtaatggattttatccgtcaaatttgtgaataaattgttagtaaaagtcgatccttgaa |
31581296 |
T |
 |
| Q |
240 |
tatcttgatttccgtgtagaaatatcttgat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31581295 |
tatcttgatttccgtgtagaaatatcttgat |
31581265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University