View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2897_low_11 (Length: 235)
Name: NF2897_low_11
Description: NF2897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2897_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 38 - 219
Target Start/End: Complemental strand, 9161804 - 9161623
Alignment:
| Q |
38 |
gcatgcagtttctacccctatacccacagtctctaatagtgcaaacctcctcgctttaagaagcataagaactgctcagagtcatggaatcatttcacaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9161804 |
gcatgcagtttctacccctatacccacagtctctaatagtgcaaacctcctcgctttaagaagcataagaactgctcagagtcatggaatcatttcacaa |
9161705 |
T |
|
| Q |
138 |
tagacatagaaaagaaatctgcatgcaactattgtgatggaaaatgaagtatgataatgcaactaattctatgtgtgttcat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9161704 |
tagacatagaaaagaaatctgcatgcaactattgtgatggaaaatgaagtatgataatgcaactagttctatgtgtgttcat |
9161623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University