View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2897_low_13 (Length: 211)
Name: NF2897_low_13
Description: NF2897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2897_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 72 - 189
Target Start/End: Complemental strand, 2975078 - 2974962
Alignment:
| Q |
72 |
catgagaggagcgcgtgggagctgccacatcgaggctagaacaaccacactaaagtcacttaaatcaattcaatatagtcaattaattcaaaaacagatt |
171 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2975078 |
catgagaggagcgcgtgggacctgccacatcgaggctagaacaaccacactaaa-tcacttaaatcaattcaatataatcaattaattcaaaaacagatt |
2974980 |
T |
 |
| Q |
172 |
tttatcattgtggaacca |
189 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
2974979 |
tttatctttgtggaacca |
2974962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 127 - 189
Target Start/End: Complemental strand, 2935631 - 2935567
Alignment:
| Q |
127 |
tcacttaaatcaattcaatatagtcaattaattcaaaaacag--atttttatcattgtggaacca |
189 |
Q |
| |
|
||||||||||| |||| ||| | ||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
2935631 |
tcacttaaatctattctataaaatcaattaattcaaaaacagttttttttatcaatgtggaacca |
2935567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 117
Target Start/End: Complemental strand, 29518675 - 29518631
Alignment:
| Q |
73 |
atgagaggagcgcgtgggagctgccacatcgaggctagaacaacc |
117 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
29518675 |
atgagaggagcgcgggggaccgtccacatcgaggctagaacaacc |
29518631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 117
Target Start/End: Complemental strand, 29519092 - 29519048
Alignment:
| Q |
73 |
atgagaggagcgcgtgggagctgccacatcgaggctagaacaacc |
117 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
29519092 |
atgagaggagcgcgggggaccgtccacatcgaggctagaacaacc |
29519048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 117
Target Start/End: Complemental strand, 32741351 - 32741307
Alignment:
| Q |
73 |
atgagaggagcgcgtgggagctgccacatcgaggctagaacaacc |
117 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
32741351 |
atgagaggagcgcgggggaccgtccacatcgaggctagaacaacc |
32741307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 4 - 123
Target Start/End: Original strand, 3875248 - 3875367
Alignment:
| Q |
4 |
tttgtcttttttgcttatattatgggacacatggagtatttgttatgctcacaacaaatctggtaggccatgagaggagcgcgtgggagctgccacatcg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||||||| |||| |||||| ||||| || ||| | |||||||| |
|
|
| T |
3875248 |
tttgtcttttttgcttatattatgggacagagggagtaattgttatgctcacaacaaatctgttaggtcatgaggggagctcggaggaccgtccacatcg |
3875347 |
T |
 |
| Q |
104 |
aggctagaacaaccacacta |
123 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3875348 |
aggctagaacaaccacacta |
3875367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 46
Target Start/End: Original strand, 32624242 - 32624278
Alignment:
| Q |
10 |
ttttttgcttatattatgggacacatggagtatttgt |
46 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32624242 |
ttttttgcttatattatgggacggatggagtatttgt |
32624278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University