View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_high_18 (Length: 372)
Name: NF2898_high_18
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 199 - 347
Target Start/End: Complemental strand, 44301572 - 44301425
Alignment:
| Q |
199 |
aggaattggatttgaacagattgttggtttggaaattgtgtttcacatttccttgtccaagagtgagttcttccattggagtactctcattagcacccaa |
298 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44301572 |
aggaattggatt-gaatagactgttggtttgaaaattgtgtttcacatttccttgtccaagagtgagttcttccattggagtactctcattaacacccaa |
44301474 |
T |
|
| Q |
299 |
ctcatatactgacataataggaaatccagtgattgttctagtttcaggg |
347 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
44301473 |
ctcatatactgacataaaaggaaatccattgatttttctagtttcaggg |
44301425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 37 - 115
Target Start/End: Original strand, 4159950 - 4160026
Alignment:
| Q |
37 |
atgcaagcttttcatgtccgataacagcaacatatgcccaattaaatgagagaccataaatggtattggttttgaagat |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4159950 |
atgcaagcttttcatgaccgataacagcaacatatgtccaattaaat--gagaccataaatggcattggttttgaagat |
4160026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 120 - 194
Target Start/End: Complemental strand, 3077418 - 3077346
Alignment:
| Q |
120 |
atcattagtgattcttagacataaataagtaagaagcccttctgcttccattgtatagatataagaaaatgaata |
194 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3077418 |
atcattagtgattcttagaagtagataagtaagaaccccttt--cttccattgtatagatataagaaaatgaata |
3077346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University