View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_high_39 (Length: 264)
Name: NF2898_high_39
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 39 - 167
Target Start/End: Original strand, 55480044 - 55480172
Alignment:
| Q |
39 |
gagggtaatttagagtcccccattaactaatactttcattgataataacaataaattgacnnnnnnncctttctattttgacatttttctaattgtgagt |
138 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55480044 |
gagggtaatttagagtcccccgttaactaatactttcattgataataacaataaattgactttttttcctttctattttgacatttttctaattgtgagt |
55480143 |
T |
 |
| Q |
139 |
gtgcccgaaatatagagggtgttaacatc |
167 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55480144 |
gtgcccgaaatatagagggtgttaacatc |
55480172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University