View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_34 (Length: 316)
Name: NF2898_low_34
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 5033139 - 5032825
Alignment:
| Q |
1 |
taattaatacatccctacacacaataaatacattgtcccattttttgtctaataatttccc-tatgtccaaccattatagcggtaccatagttaaggaca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5033139 |
taattaatacatccctacacacaataaatacattgtcccattttttgtctaataatttcccctatgtccaaccattataggtgtaccatagttaaggaca |
5033040 |
T |
 |
| Q |
100 |
atgtatataattgaaagagggtcacaggtcacaactgtggctaatttctatttgatataatattttgctgactaaatactttatggtattttgttatgat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033039 |
ctgtatataattgaaagagggtcacaggtcacacctgtggctaatttctatttgatataatattttgctgactaaatactttatggtattttgttatgat |
5032940 |
T |
 |
| Q |
200 |
aagcaatccaatagcacatgatatttattcctgccttgttgtggttctgacaaagaattcagttctccatatgtttgaaaattatacaggttggagcagg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5032939 |
aagcaatccaatagcacatgatatttattcctgccttgttgtggttctgacaaagaattcagttctccatatgtttgaaaattatacaggttggagcagg |
5032840 |
T |
 |
| Q |
300 |
tagtatgaatctgtg |
314 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5032839 |
tagtatgaatctgtg |
5032825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University