View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_38 (Length: 304)
Name: NF2898_low_38
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 36 - 240
Target Start/End: Complemental strand, 4159857 - 4159653
Alignment:
| Q |
36 |
ttgtggtcaccctctttgtgtaaagcttttgcgagtatggctgaatatttacttataacctaacatctgactaatattcaaaaattactgtgtagacctt |
135 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||||| | |||||||||||||||| |||||| ||||||| |||| |
|
|
| T |
4159857 |
ttgtggtcaccctcttcgtgtaaagcttctgcgagtatggctgaatatttagttataacctgaaatctgactaatattcataaattagtgtgtaggcctt |
4159758 |
T |
|
| Q |
136 |
atagtgcacctgagatgtgattatatgaaaattgatgtgattaatttttgtagaaacttgatgtatctgcataatatgaaaggtatcgtttactctatca |
235 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||| |||| | |||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4159757 |
ataatgcacctgagatatgattatatgaaaattgatgtgattaagttttatggaaaattgatgtatctgcataatatgaaaggtattgtttactctatca |
4159658 |
T |
|
| Q |
236 |
aattc |
240 |
Q |
| |
|
||||| |
|
|
| T |
4159657 |
aattc |
4159653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University