View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_40 (Length: 295)
Name: NF2898_low_40
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 12020415 - 12020131
Alignment:
| Q |
1 |
ccactcaaacatatatgatagacacgtggcgcatttgcattctgctgacatgttagccacttcaattccttaccattggttctgattagtctttaaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12020415 |
ccactcaaacatatatgatagacacgtggcgcatttgcattctactgacatgttagccacttcaattccttaccattggttctgattagtctttaaattt |
12020316 |
T |
 |
| Q |
101 |
ggtaccagttttagttaattaatttgtattactcagaaaaagcaaggaaccttgtatt----gtatctcaccggttttgttgtgtttgttcacttagtga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12020315 |
ggtaccagttttagttaattaatttgtattactcagaaaaagcaaggaaccttgtattgtatgtatctcaccggttttgttgtgtttgttcacttggtga |
12020216 |
T |
 |
| Q |
197 |
ttatgtatccacacaagaacctcgtacgtacctgactgcttttgtgtctatgttcattc-ttcttttttgaaaaagcatgttcat |
280 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12020215 |
ttatatatccacacaagaacctcgtacgtacctgactgcttttgtgtccatgttcattctttcttttttgaaaaagcatgttcat |
12020131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University