View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_42 (Length: 267)
Name: NF2898_low_42
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 248
Target Start/End: Original strand, 17211076 - 17211307
Alignment:
| Q |
17 |
acatggaagagacaatgaaagtgaaagagacaacgaaagtggacgaagtggtgaaggccggagaagttggggagattgggggcgttggcgtgattgggga |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17211076 |
acatggaagagacaatgaaagtggaagagacaacgaaagtggacgaaggggtggaggccggagaagttggggagattgggggcgttggcgtgattgggga |
17211175 |
T |
 |
| Q |
117 |
cctggcataggcggcctaaaaggagggcgttggggacgtaaatgaaaatcagtcgcatgcatgtatattgtatcccatgcactatgtaaagtaaaagcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17211176 |
cctggcataggcggcctaaaaggagggcgttggggacgtaaatgaaaatcagtcgcatgcatgtatattgtatcccatgcactatgtaaagtaaaagcat |
17211275 |
T |
 |
| Q |
217 |
gaattctatcttacttcatgcctagtcaataa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17211276 |
gaattctatcttacttcatgcctagtcaataa |
17211307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University