View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2898_low_44 (Length: 264)

Name: NF2898_low_44
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2898_low_44
NF2898_low_44
[»] chr4 (1 HSPs)
chr4 (39-167)||(55480044-55480172)


Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 39 - 167
Target Start/End: Original strand, 55480044 - 55480172
Alignment:
39 gagggtaatttagagtcccccattaactaatactttcattgataataacaataaattgacnnnnnnncctttctattttgacatttttctaattgtgagt 138  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||    
55480044 gagggtaatttagagtcccccgttaactaatactttcattgataataacaataaattgactttttttcctttctattttgacatttttctaattgtgagt 55480143  T
139 gtgcccgaaatatagagggtgttaacatc 167  Q
    |||||||||||||||||||||||||||||    
55480144 gtgcccgaaatatagagggtgttaacatc 55480172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University