View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_46 (Length: 262)
Name: NF2898_low_46
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_46 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 24263143 - 24262899
Alignment:
| Q |
18 |
aattttgcagtaaatttgtgatttaacatctctctatatacatctgtgagcttataagaacttttatataagtgaaggaccataaacttattttaattga |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24263143 |
aattttgcagaaaatttgtgatttaacatctctctatatacatctgtgagcttataagaacttttatataagtgaaggaccataaacttattttaattga |
24263044 |
T |
 |
| Q |
118 |
gaagttcttataaactagaaaagaccaagcaataataatttaaaaagtgtcacatatgacacaataccaaaagcaaacagaagatcctagtaatattcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24263043 |
gaagttcttataaactagaaaagaccaagcaataataatttaaaaagtgtcacatatgacacaataccaaaagcaaacagaagatcctagtaatattcca |
24262944 |
T |
 |
| Q |
218 |
tattcttgccagatcatatctcacataaagcataatgcaattgct |
262 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24262943 |
tattcttgccagagcatatctcacataaagcataatgcaattgct |
24262899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 98 - 138
Target Start/End: Complemental strand, 27241968 - 27241928
Alignment:
| Q |
98 |
cataaacttattttaattgagaagttcttataaactagaaa |
138 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
27241968 |
cataaacttattttaattgagaagctcttataagctagaaa |
27241928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University