View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_48 (Length: 259)
Name: NF2898_low_48
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 17104540 - 17104298
Alignment:
| Q |
1 |
catattcggtgatggacttcttgtcagttgtttggacaagaacggaaacattgcttgttgcatcaaaattatcctcgtatctaagaacctgaccagggaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17104540 |
catagtcggtgatggacttcttgtcagttgtttggacaagaacggaaacattgcttgttgcatcaaaattatcctcgtatctaagaacctgaccagggaa |
17104441 |
T |
 |
| Q |
101 |
ttctctctctttgcttggattccactttgctggaaccaacagtttgaatccatctccattgtatggcaagaagtctgtgtttgtctttgcctttccaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17104440 |
ctctctctctttgcttggattccactttgctggaaccaacagtttgaatccatctccattgtatggcaaaaagtctgtgtttgtctttgcctttccaaag |
17104341 |
T |
 |
| Q |
201 |
acattggctgcaacgaaaataatcaaacataaacattgcttat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17104340 |
acattggctgcaacgaaaataatcaaacataaacattgcttat |
17104298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 213
Target Start/End: Complemental strand, 39369557 - 39369416
Alignment:
| Q |
72 |
tcctcgtatctaagaacctgaccagggaattctctctctttgcttggattccactttgctggaaccaacagtttgaatccatctccattgtatggcaaga |
171 |
Q |
| |
|
||||| ||||||||||||||||| | | |||| ||||||||| || |||||||||| ||||| | | ||||||||||||||||| ||||| | || |
|
|
| T |
39369557 |
tcctcatatctaagaacctgacctgtgtattccacctctttgctagggttccactttgagggaactgataatttgaatccatctccatcatatggtagga |
39369458 |
T |
 |
| Q |
172 |
agtctgtgtttgtctttgcctttccaaagacattggctgcaa |
213 |
Q |
| |
|
|||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
39369457 |
agtctgtgtttgtcttcggttttccaaacacattggctgcaa |
39369416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University