View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_52 (Length: 252)
Name: NF2898_low_52
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 236
Target Start/End: Original strand, 33553291 - 33553516
Alignment:
| Q |
11 |
atgaacgtgcttcaactttccccatttggatgcatgtgaattgaaacagtggttgtagtggattttgttcctgaaggaacagtgaaccggtttgaaccgg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33553291 |
atgaacgtgcttcaactttccccatttggatgcatgtgaattgaaacggtggttgtagtggattttgttcctgaaggaacagtgaaccggtttgaaccgg |
33553390 |
T |
|
| Q |
111 |
aactctgagtttagagggagtaaagtgcaatttgttaaagttcccatttttcttcaccggagaaataaagaagatgaaaggaataaaacgacggtgcgtt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33553391 |
aactctgagtttagagggagtaaagtgcaatttgttaaagttcccatttttctacaccggagaaataaagaagatgaaaggaataaaacgacggtgcgtt |
33553490 |
T |
|
| Q |
211 |
tcagtgggatgggtttgacaccataa |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33553491 |
tcagtgggatgggtttgacaccataa |
33553516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University