View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_57 (Length: 250)
Name: NF2898_low_57
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 11 - 140
Target Start/End: Complemental strand, 28470283 - 28470154
Alignment:
| Q |
11 |
cagagaccaacgcatgggaagtaatttaaggatggctttaccaattgaataataaaactagtgcggacataccctaataaattctttaaggacattaaag |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28470283 |
cagaggccaacgcatgggaagtaatttaaggatggctttaccaattgaataataaaactagtgcggacataccgtaataaattctttaaggacattaaag |
28470184 |
T |
 |
| Q |
111 |
ttgatctataaatcatcatttaaacaaata |
140 |
Q |
| |
|
| |||||||||||||||||||||||||||| |
|
|
| T |
28470183 |
tggatctataaatcatcatttaaacaaata |
28470154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 139 - 235
Target Start/End: Complemental strand, 28469884 - 28469789
Alignment:
| Q |
139 |
tattaatgtgagttgttttggaaataactttgcataaaagtatgtgaagggtgaggagttgtcgaacataaaagcaactcattatgtggcacgtcat |
235 |
Q |
| |
|
|||||||||||||| ||| || | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28469884 |
tattaatgtgagtt-tttcagataaaactttgcataaaagtatgtgaagggtgaggagttgtccaacataaaagcaactcattatgtggcacgtcat |
28469789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University