View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_60 (Length: 249)
Name: NF2898_low_60
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 36391902 - 36392135
Alignment:
| Q |
1 |
ggtgtaaatggaaaagtgttcaccagaaataaaaattcatgatccacaatcacttctgtgtagattgtaaaagttagcttgtgcacggaccttgaaactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36391902 |
ggtgtaaatggaaaagtgttcaccagaaataaaaattcatgatccacaatcacttctgtgtagattgtaaaagttagcttgtgcacggaccttgaaactc |
36392001 |
T |
 |
| Q |
101 |
ggtatgaaccacaattttcggacacacaaaaggttttgaaatcatatggcagaatcaaatctcgtccagagttggaacctggccaaccacatccacttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36392002 |
ggtatgaaccacaattttcggacacacaaaaggttttgaaatcatatggcagaatcaaatctcgtccagagttggaacctggccaaccacatccacttag |
36392101 |
T |
 |
| Q |
201 |
agataaccttttgagattttctaattgaaataat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36392102 |
agataaccttttgagattttctaattgaaataat |
36392135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 119
Target Start/End: Complemental strand, 36389280 - 36389179
Alignment:
| Q |
18 |
gttcaccagaaataaaaattcatgatccacaatcacttctgtgtagattgtaaaagttagcttgtgcacggaccttgaaactcggtatgaaccacaattt |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36389280 |
gttcaccggaaataaaaattcatgatccatagtcacttccgtgtagattgtaaaagttagcttgtgcacggaccttgaaactcggtatgaaccacaattt |
36389181 |
T |
 |
| Q |
118 |
tc |
119 |
Q |
| |
|
|| |
|
|
| T |
36389180 |
tc |
36389179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University