View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_63 (Length: 247)
Name: NF2898_low_63
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_63 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 34687831 - 34688060
Alignment:
| Q |
19 |
ttgacaaaattaaaagtgacactttaactttgttgaatccagacgtgtagtgacggcaagccactttagttttggcaaactcaccgc-aaattccaac-- |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34687831 |
ttgacaaaattaaaagtgacactttaactttgttgaatccagatgtgtagtgacggcaagccactttagttttggcaaactcaccgcaaaattccaacat |
34687930 |
T |
 |
| Q |
116 |
-atatactatctgaactatgctaattggtgtgcaaca-ttgaaatagtacgttagtattaggtctatgttttgtatcacagtaaacatgtcagaatcacg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34687931 |
aatatactatatgaactatgctaattggtgtgcaacatttgaaatagtacgttagtattaggtctatgttttgtatcacagtaaacatgtcagaatcacg |
34688030 |
T |
 |
| Q |
214 |
atgactgactaattgtgattttgcatagaggctc |
247 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
34688031 |
a----tgactaattgtgattttgcatagaggctc |
34688060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University