View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_67 (Length: 236)
Name: NF2898_low_67
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_67 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40779809 - 40779589
Alignment:
| Q |
1 |
tattttcagataaaatacactactaaaatttaactttttataagatccaacattttcggggatttaataaacaatcacctaatatttttaccctggctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40779809 |
tattttcagataaaatacactactaaaatttaactttttataagatccaacattttcggggattgaataaacaatcacctaatatttttaccctggctgg |
40779710 |
T |
|
| Q |
101 |
cccttaaccttttgcatttctctctggaaaaagtttatgtgcattattgggtttttaaaaataaaataaaattgaacaaatatttaaacattcataacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
40779709 |
cccttaaccttttgcatttctctctggaaaaagtttatgtgcattattgggtttttaaaaaaaaaaaaaatttgaacaaatatttaaacattcataacat |
40779610 |
T |
|
| Q |
201 |
ttacaaatcgtgtaaagaatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40779609 |
ttacaaatcgtgtaaagaatt |
40779589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University