View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_70 (Length: 233)
Name: NF2898_low_70
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 8743017 - 8743214
Alignment:
| Q |
19 |
caaccttgagacatgtaaagctggattctacgatctcggtgttcaagattatattcttcctctcatgtccaacaatgttactaaattgctaagtaacact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8743017 |
caaccttgagacatgtaaagctggattctacgatcttggtgttcaagattatattcttcctctcatgtccaacaatgttactaaattgctaagtaacact |
8743116 |
T |
|
| Q |
119 |
ttggctcttaacaaagttcaacatcatcaagaacctagctacaaagatgggttcccaacatgggttaggccaggtgatagaaagctattacaaacttcat |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8743117 |
ttggctcttaacaaagttcaa---tatcaagaacctagctacaaagatgggttcccaacatgggttaggccaggtgatagaaagctattacaaacttcat |
8743213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University