View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2898_low_75 (Length: 225)

Name: NF2898_low_75
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2898_low_75
NF2898_low_75
[»] chr4 (1 HSPs)
chr4 (20-206)||(56312444-56312630)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 206
Target Start/End: Original strand, 56312444 - 56312630
Alignment:
20 gaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcagataggatgattcgaactgaaaacttccgttca 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
56312444 gaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcggataggatgattcgaactgaaaacttccgttca 56312543  T
120 attggactcaagaaaaccctagttttctattctggaaaagctcctaaaggcatccgaaccagttggattatgaatgagtatagatta 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56312544 attggactcaagaaaaccctagttttctattctggaaaagctcctaaaggcatccgaaccagttggattatgaatgagtatagatta 56312630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University