View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2898_low_79 (Length: 205)
Name: NF2898_low_79
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2898_low_79 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 23 - 118
Target Start/End: Original strand, 27845040 - 27845134
Alignment:
| Q |
23 |
ggttttatgaaaatgtgtttaaaatttcaatgtagtaacaagaacaaatatattagtgtctgttgttgatgtacggtaggatcaatgatgatatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
27845040 |
ggttttatgaaaatgtgtttaaaatttcaatgtagtaa-aagaacaaatatattagtgtctttcgttgatgtacggtaggatcaatgatgatatgg |
27845134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 73; Significance: 1e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 23 - 118
Target Start/End: Original strand, 20140056 - 20140149
Alignment:
| Q |
23 |
ggttttatgaaaatgtgtttaaaatttcaatgtagtaacaagaacaaatatattagtgtctgttgttgatgtacggtaggatcaatgatgatatgg |
118 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20140056 |
ggttttatgaatatgtgtttaaaatttcaatgtagtaac--gaacaaatattttagtgtatgttgttgatgtacggtaggatcaatgatgatatgg |
20140149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 23 - 118
Target Start/End: Complemental strand, 22192813 - 22192720
Alignment:
| Q |
23 |
ggttttatgaaaatgtgtttaaaatttcaatgtagtaacaagaacaaatatattagtgtctgttgttgatgtacggtaggatcaatgatgatatgg |
118 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22192813 |
ggttttatgaatatgtgtttaaaatttcaatgtagtaac--gaacaaatattttagtgtatgttgttgatgtacggtaggatcaatgatgatatgg |
22192720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University