View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2898_low_79 (Length: 205)

Name: NF2898_low_79
Description: NF2898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2898_low_79
NF2898_low_79
[»] chr5 (1 HSPs)
chr5 (23-118)||(27845040-27845134)
[»] chr6 (2 HSPs)
chr6 (23-118)||(20140056-20140149)
chr6 (23-118)||(22192720-22192813)


Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 23 - 118
Target Start/End: Original strand, 27845040 - 27845134
Alignment:
23 ggttttatgaaaatgtgtttaaaatttcaatgtagtaacaagaacaaatatattagtgtctgttgttgatgtacggtaggatcaatgatgatatgg 118  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||    
27845040 ggttttatgaaaatgtgtttaaaatttcaatgtagtaa-aagaacaaatatattagtgtctttcgttgatgtacggtaggatcaatgatgatatgg 27845134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 73; Significance: 1e-33; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 23 - 118
Target Start/End: Original strand, 20140056 - 20140149
Alignment:
23 ggttttatgaaaatgtgtttaaaatttcaatgtagtaacaagaacaaatatattagtgtctgttgttgatgtacggtaggatcaatgatgatatgg 118  Q
    ||||||||||| |||||||||||||||||||||||||||  |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||    
20140056 ggttttatgaatatgtgtttaaaatttcaatgtagtaac--gaacaaatattttagtgtatgttgttgatgtacggtaggatcaatgatgatatgg 20140149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 23 - 118
Target Start/End: Complemental strand, 22192813 - 22192720
Alignment:
23 ggttttatgaaaatgtgtttaaaatttcaatgtagtaacaagaacaaatatattagtgtctgttgttgatgtacggtaggatcaatgatgatatgg 118  Q
    ||||||||||| |||||||||||||||||||||||||||  |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||    
22192813 ggttttatgaatatgtgtttaaaatttcaatgtagtaac--gaacaaatattttagtgtatgttgttgatgtacggtaggatcaatgatgatatgg 22192720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University